Description :
From Genome Similarity Track
Location :
Scaffold_64:240728- 242247
Transcript NameFunction/comments
Phyci_313963conserved hypothetical protein

Sequence
1519 bases(100 bases per row)
ATCTACTCGTCCTTCAGGTAACTGGACTCGTCTGCTGGCCACAGCGCTCCCCAGTGCGCCTTGCGTGACGCACGATACACGTCGCGGATAGCCTTACCTC
TGGTGACGCTGCGGCGCTCCATCGTTCCCTGTATTCAGCAAAATACCGCAAGTGCCCATTAGCGATTCGTTGCGAGGCTTCAAGCGATCAACCAGTATGC
TTACCTCTGGAGTGCACAAATCAAGATGGACGTGTCGCGTTGCGAGCAGAGGACTTCTCAGCATACGTGCAATCGGCTTCTTCTTCTTGGCAGCTGCATC
TTCGTCGCTCCCCTTACGGGTCTTCTGCATGATCATGTACGAGAACTTGGAGCCCTTTTGTCCGTGCCAACGCTTTGTGGTGGCCTCACGGGGGCGGTTC
ACGACTGGCGAGCGCTGCACGAAGTGGCACCACGTACTCCCCGCTGCTGGACACTACCAACGTAGAAAGAAAAAAAAAAGTTAACATTTGCAGCAACAAC
AGATATGACAGCTATCATCTTACCTCAAAATGATGCGGGCACGGTGCGATGATGCGCACGTCCTCCTGTCCGTTCTCGTCTTCTTTCACCGAGTCCAGCA
CGAACTGGCGCGCCGAGCGCACATGGTGCGACCCCCACGGGCTGCCGCGGTCCACGATCACCAGACAGCCGTTCTCGCTCAGCAGCTCCCACAGCGCCGA
GGTCGTCGCCACGCGCTCGAAGTCGTTCGTGATGTCCGAGAACACGTAGCTCACCACGATCAGATCATACTTGTTGCCTGCATTGATGTCCCGCGACAGG
TCGGCGATGTTGCGGCGCACACTGAGGCCCGGGAAGCCGTCCAGCAGCACTTCGGCCGCGTCCACCATGGACTGGCTGGGCTCCACGACACGGTACTTGT
CCAGCGACTGCTCGTAGAAGTCCTTGGCCACCCACGAGGCCGTGCCCGGGCCGGCGCCGAAGTCCAGCACAGACGCGGGCTTGAAGTCGGGCAGCCGCTT
GTGCAGCTCGGTGAACACGGCGTGCGTGCAGGCGTAGGTGGCCTCCATCTCGAAGGCCAGGAAGGCCAGCGTCTCCGCCGGCCCGTAGGCGAAGGGCGGG
ATCTGCTGGCTGCGGTCCATGGTCCAGCCCAGCGGCGTCTTGCTCATGTCCAGCGGCAGCTGGCGCGTGTTGCGCGGGTCGCCCACGTGCTTCTGGCGCA
GCGTCTCGAGCTGCGAGTGCGTGCGGCTGCGCACCACGGACGTCAGGCGCTGCAGCAGCTCGGCGGGCATCTCCACGCGCTGCGCGAGGCCGTTGCGCGA
CAGCCGCTCGATGTCGGCCAGCAGTGACGGGGTGCGCGGGTCCGGAGCGGCCGCCTGGGCGCTGGCCTTGGCCCGGCGCAGGCGGCGAGCGCGCCGGTTG
GCGGCCGGCGACGAGAAACTGGCCGAGAGCACGGCCGCGCTGGCGCCTCCTACCGCGACGCCATGTGCGCCGAGCGCCCGCAGCAGCGTCAGGCGAGACA
GCATTTTGGTGGTGGCGAC