Description :
From Genome Similarity Track
Location :
Scaffold_1825:2407- 3660
Sequence
1253 bases(100 bases per row)
CTGGTGATGAGTGAATCCACGTACCCGGCCCTCGGGATGGCGTCCGCTGTCCGAGGGAATATCCACTCAGCCCGAAAAGGCAACTCCGGAAACAGGACCG
TGATCTTCATGGAGATGACCGCGACTCGATTCAATTTCTTGGCTGACCAAGGCTCGATGTCTCTGGTAGCGAAGGCCACGGGAGCACGTCTACCAGGAAT
GAAAGCGGCATCCGGACCAAACGGAGCCACGGGGAGCATCCCTGGCAGTGACGAGTTAGGGGGAGCGGGGATCAAGACGGATCCAGGGGATCCGCCACCG
TGAGATGATCCCGGGGATCCGCCACCATGAGGCGATCCCGGGGATCCGCCACCATGAGGCGATCCGGGGGAACCGCCACCATGGGGCGATCCTGGAGATC
CACCACCATGAGGTGACCCCCCTCCACCTGATCCGGGAGATCCGCCACCAGGCGACCCCCCTCCACCAGATCCGAGGAGTCCGCCACCACGAGGCGACCC
TCTCCCACCATCACTACCCGATCCGCCGTCACTGTCGACTTGGATCGCGGATCCCGCAGTGTCGCCTCCGGATCCGGCTGTGCCAGCGACTTGTGGAGGC
GGCGTCGAGAGGGATCTCCGCCGGGCTTCGGACCGGGATTGGGAAAGAGTCCGTCGCGTGTCTTCCTCCAAGGCATCCTCAGCGGCTTGAGCCTCCTCCG
AATCCTCTGGACTCCCGTCGTCATCATCGTCGTCGTCATCGTCCTCATCGCTCAGAGTGAAGGGATACGGGCCGGAAGACGACGTATGCTTCGACGACGA
TCGGTTAGGAGGCCCTGAGCCGTCAGACCAGTCTGACTCCTCATCCTCGTCGTCCTCCGAGCTGCCAAGTCCACATCCCGGGGGAATAACACGTATAGCT
TTCTCCTTCCCGGGTCCAGCACGGGCTGGCGGATGGCCGATGGAGGCTGGCCGGGGAACGGCCGGCGTCGTCACCGAAGGACCGGCGGTGGATCCCGTCT
TGGACGTAGATCCCGTTTTGGCCGTCGATCCGGACTTGGACACCGCTGATCCTGTTTTGGATGGGGCAACGGATCCAGTCTTGGACGCCGTAGACCCAGT
CTTGGGTCCGGATCCAGATTTTGACGTAGCAGCAGTGGATCCAGCCTTGGATCCCACTCCCGCTTTGGACGTAGCAACGGGTCCAGTCTTGGACGCCGTA
GAAAGCAGTCTGGGATCCGGAGCCAGACTTGGACGTAGCGGCAAATGCCAGTC