Description :
From Genome Similarity Track
Location :
Scaffold_16:24069- 30647
Transcript NameFunction/comments
Physo_261931Eukaryotic/viral aspartic protease, active site

Sequence
6578 bases(100 bases per row)
ATGACCTGTTCGACTTGGACATCGAAGTGCCAAGAACCGCGGCCGCCGTCTCGACGGCGACAGCCGGCGGCGTAGCCCTCGCCCGCGTACGCCTCTCAGC
ATCTTCCGAGCTGAAACAATTCTCAGGACGGGACGCCAGCGAAGAGAAAGCCAGACTGTGGCTCAACCGTCTGAAGTCCGCCGTGCGGCGCGACGGGATG
ACGGGCGAAGAAGTGTGCGGGCAGTTCAGCGATCTAATGAGCGGCCCTGCGCGCCAATGGTATCTCCAGTTGCCCAGGAAGGTCAAGAAATCATGGACCG
AGCTGATGGAGCAATTCCGGGTGCAGTACTGCGGCAAGGGCGTGTCAATGGCCAGTCGCTACTACCATGCGGCTCAGCGCCCCGACGAGACCCCTCTGGA
TTACTTGTACCGGCTCAACGTCGCGGACATGAGGGCCAACATCCCATACGCCGAGGGCACGACTGAAGAGAAGCGCGAACACGTCGAGCATTTCATCCGG
ACGCTGAACACACAGGAGGCCGAACTCGCCTCGCGTCTCACGCTGATGGAGGTCGCCGACTCCGAGGCGCTGGAGAAGAAGCTGCGTGCCCGACAACGTG
GATTGGCTCACCAGAAAAAGACTCTCTTCGGCTCGAACAAGTTCCGCCAAAAGGCGCCGACCCCGCCGACTCAGCCGGCGCGCGCCGTGCATGCGATTCA
CGTCGCGTCGGACGAGTACGACTCGGAACGCGAAAGTCGCGACAGCGACGATCGCCAGTACGACCAAGACGAGGCGGACGAAGAACGCGCCAAGTTGTTC
GTCGCGGGACAGGCCCCACCGGGAGAGCCGGCGCGTCGCAACTTCGATCCCGACGACTCGGGACGCGACCGCCCGCGGTGCCGCCACTGTGGTTCACGTC
GCCATGTCGAAAGAGACTGCTGAAAGTTGTTGACGTGTCAGAAGTGTGGTGGCCAGCACCCGACGGAGCGATGCTTGAGGGTGTGCAAGGCCTGCGGTGA
CGTGCACGAAGCCGGAGAATGCCCGATGGAGGAGTTCTTCAACCAATTGCGCCAGTGGTTTGACCCGAATAAACACGCGGGAATGCTGCCGCCGGCCGCC
GAGAAGATGTTAAACTAGGACGCTCGCTGGCTTGGAAACCAGTACGAGACGAGCGACCTGTTTCCGTCTATGCATATGTGACCAAGAAGTCGCGAGAGGT
GGTTAGTGAGAGCCCGACTTCCCTGAATGATAATACATGTGAATCCAACCTGGAACGTACCACGCAAGAACGCGCGCCGCGAATCTCGGCGGTCCGACGT
ACGACGGACGACGAGTTTGCACGTGAACCACCCCTGTACGAGATCAACTTGCAACCAGGAGAGCGACGCGGATACTGGAAACATTACGCGCCGCACAAGT
GGTACAAGCAGGCCAAGATTCATGGAAGCTGAACAACCGCCGTGCTGTGTTATTGCTCGACACAGGTGCCGAGGTGTCCATCCTGGACACCACCTTTGCT
CGTGAGGTAGGCTGCCTGATTGACACGGAGATCACGCAAGAGTGTGTGGGAATTCGTGATGAGACATATTACACGGTGGGGAGAACCAGAGTCAAGATTA
CCTTGGCTGGGAACTTGGTGTACTACATGCACCTGTGGGTCGGCGACTTGGTCGGCCAACACGCAATCCTGGGAATGAACTTCATGGTGCCCGCTGGAGT
GCGCATCGACACTGCGGACGGCACGGCGTGCCTCCCCGACGAGGTCCACATCCAGATGATCGGACGAAGACCGCTATACGGCGCACGGATGCACCCGGTC
AACGTCAAGACGCCTGTGAGGCTCGAACCAGGAGACACGCATGAAGTCTTGCTGAGGCCGGATCGAAACGCGCCGTTCCTGTGGGTGACACGGGCAGAGT
CGTGGGTGACTACCTTTGTCAAGGGGAGAGTCGGAAAGAAAACGTACCTGCGTGTCACGAACATCGGAGACGCAGCGATAACCCTCGACGCGCATGAAAC
GCTTGGGTGGTGGACGCCGTCTGACGGCCAGCCTCGGAACCGTGAATTCGTCCGACTGGGCTCCACCCGGTACCAGCAGTGGCAGAATCTGGCGTACAGC
GCGACGCGCGACGCGGAGGAGAACTGGATCCCAGCCGAGCTCGACGGACCGATGACGGATCGCCCCTCATACCCGACGCCTAAAGCCATCTTGCGCCCGG
AGCCGAGACAACTCGGGACGCGACGCGCCGTGACCCCAGTGTTGGCGGCTGTCGCGGAAGCGCCGAAGGGAAGGGGGGTAGACTTGCCACCCGACGACCA
CAAGCCGGATACGGACGAGGAGGCGGTGGAAAGCGAACCCGACATGCCTCCGACCGTGGCTGGAAGCGCTGCGATGGAAGAATCGCCGGAGTCGGAACTC
GCTGAGCCAAAACTCGACGGACCAAACCCCGCCGAGCCGAATTTCGACGAGGCGAAACCTGATGAGCAGGAGGAAGACGACGCGGTCCTCATCCACGAGG
GGTCCGACCTCTTCGTAAAGGATCTCGAGTCTGAGATGGCAGTGCTGCCAGACCTCTCGCTGACCGCCGAGGTGAAGATCGAGGACTTGAAGGTCGGCAT
GCCGACTGGACTCCCGCCCGAGGAAGCCGCGAGACAAGAAACGCGGCTACGCCAAATCATCTGGAAGCGATGAAAGTGGTTGATCGGCAAAGGCAACGCC
TTGCCGCCGGCCGCCCTGGGTGTTGTCTGCGACATCGACGTGGGCGACGCAAAACCCGTCGCGCAACGCGTCCGGAAAATCCCGCCGCAGTTTCGAGAGA
AGGTCGCCGACTTGATCAAAGGGCTGCTGAGCGCGAGGATGATCCAGAAGTCGAAGTCGCCGTGGGCGTCGCCCATTGTCGTGATCATAAAGAAGAACGG
CGTCGATATCCGGCTTTGCATTGACTACAGGCTCATCAACGGGCTGACACAGTTGATGATTTACCCCATGCCGCTCGTCAACGACTTGCTCGAAGACTTG
GACAAGTATCTGTGGTACTGCTCCCTCGATATGGCGAGCGGCTTCTGGGTCGTCCCCATGACAGACCGGGCCCGGCTCATCTCAGCCTTCATCACGCCGA
TGGGACTGTACGAATGGCTGCGTATGCCGTTCGGCCTGTGCAACGCGCCGCAGATTTACCAACGCTTGATCGACAACGCGCTCTACGGGTTCATGAAGCT
GTCCCCGGATGGCAGCACTCGGGACGTCTTTGAAGACGGCGAACCGGTGAAGCCAGGTATTCACTCCAATTGTGGGACGGAGGTCGTACATCGACGACAT
CCTCATCGGGGGCACGTCGTGGGACGACCTGTGCGAGAAGGTCGAACGCTTGCTGGATGTCTGCGAGCAGTGGCACTTGTCCATCAGTGTCGAGAAGAGC
GAGTGGGGCATGTCCAAGGTCGACTACCTGGGCCACCGAGTCTCAGGACTCGGTCTCGAGGCGAAGCGGAAGAATCTGGAGTCGCTGACGTCGCTCGAGT
TCCCGCGCACGCTCAAGGGCCTGCAATCGTTCTTGGGTAGCCTCAATTACTACCACCGGTTCATTGCAGACTTTGCGGTGTATGCAACCGCGCTGTATTC
GCTGACGGAGACCGACTTCAACGAGTACGTCACACGTCCAGAAGTCCGCGGGCATGAGAAGTGGACGCACGCGACGCGCGCCTTCGACGCGCTCAAGGCA
AAACTCGCCGAGACCCCAATGTTGAAGCACTTCGACGCGAACCGAGAATCCGTCGTGATCGTGTACGTCAGCGACTGGGCCATCTCAGGGGTGCTCACGC
AGGTCCACGACGAAGTGTACATGCCTGTGAAGTTCACCAGTCGTACGTTGAAGCCCAACGAGCTGAACTACGACATCGTCGAAAAGGAGATCTTGGCCCT
GTTGCGCGTCTTAAACGAGTGCTACACGATACTAGCAGGGAGACCGGTCCGCGTCTTGACACGTCACACGACACTCGCCTGGTTGTTCCGGTCCAAAGGA
CTACAGGGGCGACTGTCACAGTGGGCCGCGATCCTCTCGCCGTGGAAGTTGGAAATCTGCCGATCCATGAAGGGAGAAGAAGAACTCCTCGGCGCGCTGG
CCGCGAGCATTACCCCGCGAGCCTTCGTCGACGCGGCGCTAGAAGAGATCGCTCCACGGAGACGGGCGTCCAGGATTGTAGTCATTCCCGTCCCCGACGT
GGCGCGCGACGAGGTCTTGCACGTTTTGAGCTTTGACGGATCGGCCAAGGCGAAGCGAGAAGGCGGAGCATACAGTGCCGTCATTTGGCAGCTGCCGAAC
TGGGAGATCGTGCGCGCCGCGTCGGGATATGTGACGGACCTCACGGTCAACGAGGCGGTATACTGCGGGCTGCTGCTCGGATGTTCTCTTCTAGAGGAGC
TCGACGACGTCACCCGACTCGTCGTATGCGGAGACTTCAACCTTGTCATCAGACAGATGCGGGACGAGATGGGCTGCAAGTCCCCGGGGCTGAAGCTGCT
GCGACAAAAGACGCGAAACGCACTTCAGGCATGGTCGCGCCACGAACTCTTCCACGTACGACGAGACTGGAACGCGAGTGCCGACATGCTGGCTGGACAA
GCTCTGCAGCGTCAAGGAGGCCGCAACGCGCACAGCCCCGAAGAGATTCAAGATCTGAAGACGCTGAATCGCTTGGAAGAAGTCATCCGACCACGGGCAT
CAAGTCCCGAGATGGCGTCTCCAGCCAGTCCCGACGCGGATAATCTTGACGCGGAAAACCTCGACTCGGAAAATCGCGACGCGGAAAATCGCGACGCGAA
AACGCGCGGCGCAGATGGCCCCGCCGGGAAGGCCATGGACGCGGGACGCGGGACAGCACAAGTCCTCGCGGTGACGACGCGCTCGGCTGCCGCACGCACG
ACAACACGTAGGGTCCGACCTCCAGAAGTCCTGGAGGAGCTGGTGGTGCAACGACTGCGCCTGGACCGCATCCGCGTCGCCCAGGACGAAGAGGTCTGGA
TCGTCAACCTCAAGAAGTATCTCCGCGGCGACGTCGGAGACCTATCTCGGCGCGAGGTGAAGAACTGCCAAAAGCTTGCGCCTCAGTACGAAGAGCGCGA
AGGCAGGCTGCTCTACTACCAGCCCAGAAGCGACGATTCCGCCGAGGATCGCGATGTGATGATGAAGCTGGTGATCCCGGAGACTCTTCGGGAAGATGTA
CTCCACCACTATCACGCGAGCCTGGAAGGGTATTGGCCGCACGTACCAACGCGTGAGGCGCCACTTCCATTGACCAGGGATCTTCAGAAGCGTCCAGCGC
TACGTCGGCGAATGCACCGACTGCGAGACGGGAAAGGGTCGGCGACCATCCAGGGCGAGTCGCCGGGCAACATCGTCGCGACGTACCCGTTCCAGGTCAT
TGCCATGGACCATATTCCGTCGTTGCCGGCATCCTACAAAGGCAACACAGAGCTGTTAGTCTAGGTCGACCTCTTCACGGGGTTCGTCGTGGTCAAAGCG
AATACATCACGAACCGCGCAGACGGTGGCCGAGGCGTACGAGGAGGCGGTCTTCAGGCGCTTCGGCGCGAGCGAGGCTATCCGCCACGACCGCGAGCCGG
GCTTCATGTCCGACTTCTTCAATGCGTTCAGCAAACTAATGGGTCAGAGACAGCGAGCGACGCTTGCTTATCGTCCCCAAGCCAACATTGCTGCAGAACG
GATGGTGCAGACGGTTACAAGAGCGATCAAGATGTACATCGCGGACGTCGACCAACGCGACTGGGACGAATACGCCGAGCGTCTTACCTTCGCGCTAAAC
ACGTCGCACGACCGGACGAGGAATGAAACCCCGTTCTTCTTAGCGCACGGCTGGGATCCTCGGTCGACGCTGGAAGCGACGCTGGCCGTCGGGAACACGT
CGACGCGGGGCGCCGAGGCGAGGCGGTGGAGGCTCCGTATCCAGCGACACTACAAGGTGGCAAGGGCACAAGCGTTGGAGTTAGTCCGAGAGGCCGTCGA
AGAGAGAGCGCGTCGACAAACTAAAAACGCGACGCGACATCAGATCGCGACGGGCTCGCAAGTTTGGCTGTACCTGGATCGGGTGAAGCCGGGGTATGCG
CGCAAACTCGCGCACATGTGGCACGGACCCTTCCGCGTCGCCGAGCTGGTCAGCGCGTTCGCAGTGCGCCTCGAGACGACGGGTACGCCCTATCAGCTGT
ACCCCGTCGTCCACAACTCCAAGCTGAAGCCCGTCCGGGAATTCCCGTCGCGACCCACGACGCAGCTGACGGTGCCGGCCGAGGAGCGCTTCGACTTCGA
CGAGGAACTCTTGCCGGAGGACAGCTGGGAAGCCACGCGCGAGCTGGAGGACGACGTCTTCGAGGTCGAGAAGATCGTGAACGTGCGCGAGGGGCGGGCT
ACCCGGTATGGGCGCACGCGACGCCAGTTCGAAGTCAAATGGAAGGGCTACCCGGACATGACGTGGGTCGACGAGCTCCATCTGAATTGCGGCGGGTTGC
TGTACGACTTCCTGCGCCAGCGCACGGGACGCAACCGGTTCGAGGCGATGCAGTCGTACGAGAACGCGGAGGCGGCGG