Description :
From Genome Similarity Track
Location :
Scaffold_425:24067- 25156
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_425-snap-gene-0.9Conserved gene of unknown function
Pytve_DAOMBR484maker-pve_contig_425-snap-gene-0.14Gene of unknown function

Sequence
1089 bases(100 bases per row)
CTGCTTCGCGTGACGTCGATAAAGCTTGGGCAGCTGTTTCTTCGGCTTGGTTTGACGCCTCTGTCCGTATCAAACACGATCGTCGAGTCGTCTGCAACGG
AATCTCCTCCACCACTTGCTGACAACCCAGCAGTCTCAGACGCCAATCTAGCTTGCTGGACAATGGTGCAAGGGAACGTGTTAGGTCTAAACGATCCAGC
CGATCGCTTCGATGAATGTGAATCTCGAACCTTATGCAACGCGGTCGTCACAGACGCAGACGTGGCGGATCCTCTCCGACTGCCGCCGTTTCTGCAAGCA
GACATGGCCAAGCTGCACTCACCTCCATGTCGCTGCCAGCTGATGGAGTACGCAACCACACCACAGATGGTGCTCTTGGTCGCTGCGAGTCGCTGGCTTC
GATCGACTGCTGTTCATCACTCTCTCGGCGCAATCCAGCTTGATTCTCCATCGAACCTGCTCCAAGCTGCTCTACACCGATGGCTTACAGCCGTCAACAT
GCAGGTACGAACCACTTCGAAGTCAAGTCCAGATCTTCAACACTCTCGAGGCAGCCAGTCGCAGCGATCCGTGCTCGCGCACTGGCGCTTCGGCCGCGAG
TTAACCGCGTTCCACCGCTGGAAGCGCCGGGTTCGACCATCAACTGTCGCCCACCACCGCCTCGAGGCAGCGGTGGACGGCATNNNNNNNNNNNNNNNTG
CGCCGCCACCGGTTCGAGACGCTACAGCACCGCCAAGAGCACGTGCACCTCGTCGCCGCCGCGCTGCTCCACCGCTTGCCTCCACCACCATTGCATTCAT
TGGCAGTCGACTACTAGTGCACCTTAACCACCATTGCATTCATTGACAGCCGACTACTAACGCACTCCTACCTTCCTTACCCAACCAATTGCATTTTTCA
AAACTGCCTGCTGCATTCACTGCCACTCGCCATTATCTAACTCTGCGTGCGTGTCCGATCGCTACATAACTTGTCATTTTTCCCATCAACCGCGGCCGCT
ACCGGACCAGCACGGTCCCTCACAGGTCGTCCATCTCGAACACTGCGGCGCCGTCGTCGTCCACGCTCAGCAGCTCGCTGTCGTCGCCC