Description :
From Genome Similarity Track
Location :
Scaffold_368:24065- 26058
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_368-snap-gene-0.13Peroxisomal Lon protease
Pytap_DAOMBR444maker-pag1_scaffold_368-snap-gene-0.8ADP-ribosylation/Crystallin J1

Sequence
1993 bases(100 bases per row)
CTACGCCCACATCGACGTAGGAGGCGACGACGTCGGCCAGTTCTCCCACTGAGGACGCGCCGATGGCGTTGATCACGCCAGTCGTCTTGCGGAGCGCTGC
CGAGCCGCTCTTCGTCAGCTCCATGTACTCGTGCGTGAGCTCCTTGAGTCTCGCGGCACGCGACTCAACGCTCGCGGCATCCACGACCCCAGCCAGGGGC
TCCACGTTGATCACACTGGCGACCATGTACGGCGCCATTTGCTCCACGTCCTGCAGCCGCACGCGGGCAACACCCTGCACGAGAATCGTCAGGCCATTCG
AGCCTTGCACGCGCGTGAGCTGTACCACTTTGGCCAGCGTGCCCACTTCATACAAGTCTTTGACATTGGCTCCGGTGGCCTCGCTCACCACACGAGACGG
CTTTTCGTCGCCTTCCGCCGCTTCCACCGCACGCTTGGCGAACAATGCGAGCGTCAGTGTCGCGCCACTGCCTACGGCACTGCGTCGTACGGAGCTGGGC
TTGGCCTGGACGTCCCAGACCAGATCCTTGAGCAGTTGCAGGGCTGCGGGAGACGTCACCGTCAGGCGCAGATAAGTCCGCGGGAAGAGCACTTTGCCGT
CAATGGGCAGGACTGGCACCTGCATCGTTGTCTGTGGCATCTCGTAGAGTAGAATGCGTCACGTGGGCACTCGTAGGGgCCGCAGAATCACGGGGAATGC
AGCAACGTCCGTCGGTGCTTTGCTTCTTCCCCcTGCCGTATTGGGCTTCTCGAATGATGACGAAAACTTCAAGCGAACGAGTAATTAATGTGAACCACAT
TAACTAAGAAaTCCATGTGGGTCACATAAGAGACGGATCATGTGTAACCCATTCTGAGTCGGGTTATATAACTCATGCTGAAATGGGTTACTCGTTAATA
GATCTTCTTGGAGATGAAGGTGAGTTGGGACCATGCATATGGTGCGTTCTTGGGCGTGCTCTGTGGCGACGCTGCGGGCGCCACGCTCGAGTTCTGTCGT
GTGACCATCACGTCTGCTATGGCGCGAGACGCCATGCACATGCCTGGTGGTGGGCTCTTAAAAGTGGGCCGAGGACAGATCACAGACGACTCGGAGTTGG
CATTGGCTCTGGCACAAGGACTCGTGGGTCATGCGCCACGAGACGGCCTCCCACTCGACGCGATCGCCCGCAAGTATCGCGAATGGTGGCGATCGTCGCC
CTATGACATCGGCAACACTTGTAGCACGGCGTTTGGAATCCAGACGGTGGTGCCAGACATGGCTGCCAAGATGACGCAACGGTCGGCGCAATACAACACG
AACAGCGAGGCCAATGGCTCGCTCATGCGCATCCTTCCACTCGCAATCTGGGCGTCGAAGCTGCCCTcGgATGAGCTGGTTGCAGCGGCCAAACAAGAAG
CGACACTGTCCCACCCGCACCCAGTGTGCCAGGACTGCAACGCCGTCTACTGCCTCATCGTCGCCCACCTGATCACACATCCTGGAGACGGTCAAGGCGC
CCTGGAAAAGGCAGAAGTATTTGTCAACGACAACGTTGATACTGTCGTGCGTGACTGGTTCCTGAACGAGTCGCTGGACATCTCGGTTCTTGACTGCTCG
AAACAGATCGGCCATGTGCGTTGGGCGTTCAATCTCGCCATCCACTTCCTCCGCGAGAACACGTCGTACGAGCAAGGCATCCATGACACGCTGCTCAAGG
CAGGGGATACGGACACTAATGCCGCTATCGTCGGAGGAATACTTGGGGCTCTCCACGGTGCGAGTGCGATCCCCGACTTTATGAAAACGCCGGTACTGGC
ATTCGACTGTACTCGCCCAAATCCAGgCCAGCCTCGCCCGGCCGCGTATCGTAGTGACCAAGTGGAAGATATCACTCGTGCACTACTTCAAATCGCATCG
GAGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN