Description :
From Genome Similarity Track
Location :
Scaffold_3:2406222- 2407815
Sequence
1593 bases(100 bases per row)
AACCCCTGAAGACGCAGCACAAGTCTTCAAAGAATTTAGGTGAAAGGTACTGCAAACAATTGTTGAACAAAAATGTGTCCACGTATTTAATGCGGACCAA
ACGGGTAAGTTTGAAACTGTATTTTTCTTATTTTTTGTTTTCATAATATAACAACGTTTTCGCTTAATGTAGCCATTTTTTTAGTACGTTCCTAAACGAG
CAATTACAGATAAGAAACGAAGACGGTTTGGATTCGTTGCGGAAATAAGGACAAACAAAGGGCGACAGCTACGTTACTTGGCGACTCAAGTGAAAACAAA
TTTGACACTTTTGTTTTGTTCAAAGCCGCACCGTCCAAACCACAAGGCAAGCAGAAAGAAAATGACAACTTGCGAAACTGGTTTGGTACAGCAGCTTGGC
GCGAAATCAAAATACTTCAGGATAAGTATCCCTGTAGAATTTACGGCAACAACACGGCATGGTGGAACGAGAAGCTTTCGATCAATTTTTTGGAGTATCA
TTTCGCTTACCGTGAAAATCGTCACGAAAATGTTTTTTTACTATGGGACGACTTTAGCGCACATTGGACTCAGACCGTTCGTGATTTTGCAGCCTCTCTA
AATGCTGTTCTGCTCAAGGTGCCCCCCAAGTATTATTATGTGTGTCAGCCTGCTCACATCTCGTGGAATAAACCGTTTAAAGGTGAGCTTCGCGCACTGT
GGATTGATTCTATTAGACAGCAGCTACATACAACAGCGGTGAGCCAGAGCAAGTTCAGCGCAAAAAACAAAATTAAAGATGAAATTTTGCTTGCTCATAC
AAAACTTGATCAAGAAAATGCGAGTCGGAAAGTGGCTACCCGTTGAAAAAAAACTCGATGTGGAAGAGTTTTCGCTGGTCGCTCCATCAAGACCTGTGAT
GACGGAATGGATCACTTCTTGCTGGTCGAAATTGTCGTCTAAGGCAATAAATAGTGGTTTTGCGAGGGCAGGCTTCCTTACTGATGCTTGGGAGGTCGAC
ATAGAAGAAGATATCGTCGAGCAACTTGACACTTTTGCCACCAAATTAGAGCGCTACAAAATTGCAGAGGAAGAAATCGCTTCTGACGACGATATAGAAA
GTGAATGCAGCGGTGCTGAGGACGATATTGATATTGAGGACAAGTAGTATATAACTTTGCATTTATAACGTTTATTTATGTCTGTTCATTGTCGCCAACG
ACTAAGACGATACGGTATACACATGTCAAATAGGTCGTAGGATTAGAGGAGACATCCATGTTGGTTCATTTTCTGTGCTATTTCCCAGCCGTTTCTAACA
TACAAGGATTAGCACAAATTTTGCCCAGCTCACAAATGTTACATGCTGATTAGTACAGTACGTGCATATTTAGTGTCATATCGGCTCGTGATTGACCTGC
TTAAGTTTGTTGCCCGTTCCAAGATTGATGGCATGAAAGCTGAGCATGTAGTGCAAATGTGGCACGACGTCTTTTTTGTTTACGGGCTTTTGGCGGGCTT
TACGAATTTTGATATTTAGTTGATGAATACGTCACCAGTCTCTACATCTACATAATATGTAACACACGCGCTATGTCTTTCAATATTATTGAA