Description :
From Genome Similarity Track
Location :
Scaffold_20:240607- 243542
Sequence
2935 bases(100 bases per row)
CCTCGCATTCGCGTGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNCAGCGTGCGAAGAACCGTCAGGGACGTGCGCACTTCGGATCGAGCAAGTATCCGCAGGAGGCCGCCAGTTCTGACGCCAC
GAAGTCGGCTCCAGCGCGTAAGGTGCAAGCCGTCGTGACCACGAACCAGCCAGAAAGCGATAGCGACTCTGGCCTTAGCGGATCGGAGTCCGACGGTGAT
CTACGCCGGACCTACCTGGCTGCAACGGAAGGATAGTCGCAAACCCAAGCGGCTGCGCCAAACGAACCCGATCGGACCACGTCTGGCCAAACCCCGCCAC
CGCGAGACTCTGGCCCGGTTCAGAGATCCCCACACGGACGCCGTCAGTTCCAGCGTTGCACTCACTGCGGCTCACACTGCCATGACGATCTGCACTGCTG
GAAGAGACTAACCTGTCAACGGTGCGGTAAGAGAGGCCATCCGTCGGATCGCTGCCTCTTCGTCTGTCGCGGCTGCGGTGAGATCCACGACGCCGGCAAA
TGTCAGGTGGAGGCGTTTTTTACAACTTGATCCGTCAATGATACGATTCTGCCAAGCATGGAGGTGTCTTGCCCTAAAGCGCCGAAAAGATGTTAAACTA
GGACGAGCCGAGCGTTCCAAGCTCTGCATCTATACATACGTCGAGAAGAAATCGGACGTTAGTCAACGGAAGAACCTGATCGACAATGCACGTGATCTTC
ATGGGAAACGTACCAGTGTTGTTGCAAGTGTCCGGAAACCGGATGTGTTGGCGAGTGCGAGGGTACTGAAAATAACACGCACCCAGCAAGTGGTTCAAGC
AGGCCAAGACGGAACGGAAAATCAACAACGTAAAAGCGAACTTGCTCTTGGATTCCGGCGCCGAGGTGGCCATTCTGGATGTCGCCTTTGCTCGTAAGGT
AGAGTACCACGTAGACGAAAGTCAACAACAAGAGTGTGTTGGTATTGGAGAAGGCGTATATGTGACGAAAGGACGTACCAAGATCAAGGTTACCCTGGCC
GGATCGCTAGTGTACTTTTTTGACGTCTGGGTCGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN