Description :
From Genome Similarity Track
Location :
Scaffold_220:24060- 25197
Transcript NameFunction/comments
Hyaar_Emoy2812826predicted protein

Sequence
1137 bases(100 bases per row)
CGCTTACTTCTGCTTCTTGAGCTTCTCCTCGTCCTCCTCGGCCGCGTGCTGCTGAGCAAACTGCTCAATGCACGAGATTGCAAAGTACGCAATGAAAAGC
ACCATGACCCAGGAGCCTAGCTTTGAGACCAGACTGGTAGTAGGAGCCGCAGCTACACCAGCGTGCTCTGCGGCTGCCTTGACCTGTGCCGAATGAAACT
TTTCGCGGCACTCGAGCAGAAACTCGCTAACTCGGGAGCCAAGTCCCCACTGCTCAGGAGTGATACGTCCAATGAGTGCCTCCACTCGCTTCAGGTGCGC
GTCCGTAAAGATAGTGATGAAGAACGCGGCTTGCACATTGACCTTGATCAGTGCTTTGCCAATCAGCGTGGCGCCAAAAAATGTCCAGAATGGCATGAGG
AAGTGTCCACAACAGATGCCACAGAGATCAAAGGCCATATTAGGCCAAGCCGACATGAGCAAGACCCCCCAGAAGCCGTGCTTTTCCAAAAACTGGATCA
TCCAGTTCTTCATGCTGTTCATGAGGTTAAACTGGGACGTGGCCTCAGCAATCTCTTCAAACTCTTCATTGCGTTGTCCTGCAAGTTTTGCAGCACGACT
AAGTGCATAAGGTGGAATCTCTCCTGCAGCAGTACCAGCTCCCCACAGCATACAGGGCAGAAAGACTTTCCAAAAGATCGCTGCGAACGTGACGGTCGAG
ACTTGAGGGACGTGAGTGCAGTTGGCTTCGAACGGGTGGAACCACATATGATGGCGAGTATCAAAGTCCAGTGATTGACACTCCTGTGCGCCCTGCACGA
CCAGGAAAATGTGAGGGAACAGGAACAGCACGCCCGAGTGCATACCTGTACCCAGTCCCACGCTCGAGAGCACGCCCAGGCCGACCCACCAGACCACAAA
CTTGACGCTCTGATTGATCTCGTCCAAAAGCGGGCGGTGCGGTCCGTCCCGACTCGAGGCCACGAGCCACAGCAGCAGCAGCGGCAGCAGCACGAAGCGC
GTGGCGGAACTGCGCTGGATCCGGAGTGCCAGCCACTTAACAAAGCGCAAAAACACGATACTGAAGTGGTACAAGACGCTCAGAGGTCGCTGAAAAAGCG
TCAGCTTCTTCCGCTCTTGACGCAGCTGCTCCGCGAG