Description :
From Genome Similarity Track
Location :
Scaffold_2108:2406- 5954
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_2108-fgenesh-gene-0.1Flagellar radial spoke protein

Sequence
3548 bases(100 bases per row)
CTTGGAGGCCGTCGAGATCTGCCTCAAGGTGCTCTCTAAGGTCCTGCTCTCGCAGTCGATCAAGTGCGAGAGTGAAGAAACAGAGGTAGAGCTCACGAGA
GCGCTCATTGGCACGGTCATGGGGCTCTCCACGTACGAAGATGCCAAACCGCGTGTGATCGAGTATGGCGTCGAGCCTCTGGTCGCGTGCCTCAAGCACA
AAAGCGCGGCCGTGCGCAAGAACGCGAGCATCGCAATCAATTCGGCCTGCGAGTCGCCATTGGGCGCGCTCCACTTTGCCCAGCGGCTGCTCTCCGACAA
GACGCTGATGATTCAAGTGCTGGGCGTCAAGGCCATCCCAGCAATCAACAGGAGCCTCACTGGTCTCGATGAAGACGACAAGATCTGTGCGCTCGATGCG
CTCATTGAGCTTGTCGAGCATGAACTTAAGGCGGCCAGCGAGGTCGTGGAGTGTCTCGACATGGTGGACAACCTGGTCGCGCTGCTCACGGATCCGCAGT
GTGAGGTCCACCAGCGAGCTGTGGGCGTGCTGCACACGATGACTCGGGTGAGGCAGTTGCTTTGGATGGCAAGATAGGTCGACCTTGTTGAGCTCTTTGG
GCAGTAGCTGATTGTGTGGCTGTGACGTGTTGACTTGTAGCGAGGTGACGGGCTCGCGAAGCGTATCGGGAAGAAGCTCAAGAGACAGGGCGTGGGTGAA
GACGAGTTCTCCGTGATCGTGGGCATATCCAGCGCTGACTTTGCCCAGCGGTACGAGTAGGAGGAAGAGTGTCTTCATGAACGCGACACTAACCGATATT
GTAGCCATCTCTCCCAACCTGTATAATCTGATTTTGTGGATATCATCTAATGCGATGTACTATTTTATTTAGGACATGTTATAATGGAGGTACTCGCAAA
CTGACCATTTTTTCAAATAGCAAATGTATCATAATTACATTCATCTAGGTTCTGGAAGTGACGTCCATTTGTATAAGCATTTATACCACTATTTTTTGTG
ACGGGTTGTGTTCGTTGAGCCGAGAGACGGTTAGCATCTCCCTCGACAAGGACGGGATTGCGCCTTCGTGCGTATCCAAACCTCTATGGTTTAAGCTCTG
TCTGCTCGAAAGAGTTTGACATCTCTACCAGTTTTTTTCAGTGCCTACCTCTGAGAACATGTGATTTGCCGAGGGTTGCTAGCAGGCGAATATGCACCAA
TCAAATTGGCGTAAAATCTATTTTGCAAACTCATCTCACTTTCCATTGGCCAAAAAAATAAATGTCTTTTTTAGAGTTGGAAATTGCGGCAAAATGACTG
CGCATCAAGAGGAAGCTGATGCTACGACGGTCGATGTGCACTGCAGCGATGGAGAGAGCGGCGGTGGTGACACAGAGGCGCAGCTCGTGAAGACCGACCA
GAAGAAGCGGAAGCGCAACACTGAGCAGCCTCATGATGCGCAAGGCGCCAAAGGCGAAGAGCTCCATGAAACGAAGCGGCGTGATGCTCGTCACGGCTCT
CTTGACATCGATTCAAGTCCATCAGGTCTACTACACTCTATCTCGCGTGCGGTTGCCATCACAGCAACGAAGTGTGTGAGCTCACTTGCAGAATTGTTTC
AATTGGCCTGCCTGCTGTAGAGAGCGAGACCCCAAGCACAAGAATGGACGACGACTGTCAGCTGCTAGAAGTTGCTACGAGCGAGACGCCGACAGCCAGT
AGCGCTGCGTTGCCAGAGCCACCTCAGGAGCAACTCCGCGTCGCGATCATCGTGCCATTTCGAGACAACCACGCAGCGCAGAAGCGCCAGGCGCATCTCG
ACCAGTTCCTCCCACACATGACAGTGCTGCTCGCCAAGCAGAGCGAGTTGAGGTGCGGTTATTATTTTTATTTTATTGTTCATTACTCACTGGGAACTGA
GTCAATGTGATTTGTCGGTGATTGAATATTTTGAGCAGCTTGTTCCACATATTTATTATTGAGCAATCCACGGACGGACGCAAGTTTAACCGCGGCAAGC
TGCTCAACGCCGGCTTTGACATTGCGCGCAACGATTACGACGTTTTCATCTTCCACGACGTCGATCTGTTGCCCGGGGTGAGTGTTTATTGCCTATGGGG
TTGGACTTTAGCTAGGTGTACCTAATTATTCATGATTGTTTATTCTGTGGTGGGTATAGGACGACCTGGGCCAGTACTACGCTCAGAAGCCAGAGCTCGG
GCCGTTCCACATCGCGCGTGTCTGGGATCGGTGAGTCACAATGAACGGTTTGAAGTGATGCAACAAAGAAACCTGAGTGCTAATATTGGTGGTGTCTGTC
TTTACAGCTACAATGGCAATCCCAAGTACTTCGGTGGGGTCGTGGTGTTCACCCGAAAGGATTTCATCAAGATCAACGGCTTCCCGAACAATTTCTGGGG
GTAAGCATGGCATTCAGTGGCGATCATTCAAGCTGCTGGCATATTTCCCTTAACTCTTCTTTGCAACTGGAATATTTATGTTTGCAAAGGTGGGGAGGCG
AGGACGATGAGCTTTACTGCCGCGTAATGAAGAAGAAACTCACGATCCAGTCGCCGCTCAGGTACGCAAACGACAACTTTCTACTGCAAAATCTGTTGAA
ATTGGTTTTCGATTTTGATTCGTTTTATTCTTATGAGACTGCAGTGGCACGATCACGGATTTGGAGGAGATGGGGCTAATGGAGAAGCTCGACACGCTAC
GCAACACCAAGTGGAAATGCACGGTAGGGCTGACGATTTGATTCGCCCGTCACTCAACAAACGAAGTGCTTTGGCTGACATGTTTCTCATTATTTTTATT
TAACGCAGGTGAAGCGTGAGCTCCTGAAGGAGCACGCGCGCACATGGAAGAAGAATGGAATCAAGTCGCTTCACTACGACTTTGTCGATTCCCAATCGCT
GAGCGACGTATGCACCAAGATCACTGTGAAGCTGGGCGAGAACGGCCACTGGTCCGATGCGCGGTCGTCATTAGAGCATGTCGCCTCGGAAGGCGAGGCG
AATGGCGCAAATCAAATGAACTCGGCCCAGTCCGAGCCGCAGACAGAGTCCACCGTATCGGTTGTACAGTCAACGCACACATTCTTTACGTGAGGACCAT
CAATTCGACCAATTTCCATTTTCGCAAATTTGCATTTGTTGGTCTATTTGTGTAATTATTAATAGGGCAATAACCAAAAATGGTACACTTTGGCACTTTT
AGCCAATCCAAGGTAACGTAATGCAGCAATTTATGGCACGCATCAAATGTTGGCAGCACTACAATTTATCAGCCAATAACATAGCCCAAAATGAAAATCA
CGAGGTTTGATTGGTAATTTTAGCACCGCAGCAGTTTTTGGCAGATTCCCCCTCTCTGTGGCCACTTGAGAAGAAGAAAGAAGCCGCGATGAGCGCGCAA
GCGCGGCGGAAGCGCTACTGTGAAGAAGACCTTGCAGAGGCGCTCGAAGAGCACGAGCGCGGCGGCGCAAAGGTCACGCAACTGAGCAACAAGTTCGGCA
TCTCTGAGCACACGCTGCGGCGAAAGATTGCGGAAAGGAAGGCAGACC