Description :
From Genome Similarity Track
Location :
Scaffold_1435:2406- 4675
Sequence
2269 bases(100 bases per row)
GGATCTCAATCCGACGATCCCTCTGCAGGATCTTTCGCGGAGTTGGGTATGAAGGCCGATCCACCAAGGGGCCAGTTGGCCTCGCCGGGGCCTCCCCTTC
TCCGAGCGATTCAATCTCGATAGTCGCCTCGTACGCCAGATTCTGCCATTCTCTGTAACGACGGGATCCCACTGACACATATCCAGGTCGCCTTGGGATA
CCGGCCTTCGCCAACCATCGTCCGATGTCCTCATAATGGTCCAGTAGTAGTCTCTTGTCGCTGACGTTCGTGACCTGGAGGTATTGTGATCGACCTGGTC
CCTGGATTACGGTAGGCACCCACTTCTCGCCCCGGGTGACCCACCGTTTCTCATGTTCCACCCACTTTAACCGATCTGGCAGCTCCCAGGTTTCTCCGGG
CTCGATCCAGGTCGTCTTATCTGCCCTTATGATCCTCATCTTCGCCCCGTACAACGGTCGCCGTCCACTGAGCTGGATCAGCATCTCGTCCGGGAAACAC
AGTGTCCCATCCGCCAGATCCAACCTCACTCCAGCCGGGTGGGAAGAAGAAAAATCTCTCCCCGGAGGAAGGTCTTTCTGAACCAGGGAGAATCTTCCAA
CCCAAAATAATCTAACCCTTATATTCAAAAATCTCGGCCCAGCGGGAACTCGGAACTCCGGTTCTCCCCATTGTTAAGGTTAAAGCCCTCTCACCACACT
CAAAAACATACTGGGAATGACTCCCATCACTGGCACCCAAGCTTACCAGCAAGGCGGTATCTAGTATAGACACCTCGGCACCACTATCTAGGAGTAGGAT
TGCTTTTTCATTGTTGATCTTGCCCCCTACCTTGGCTTGTCTGAACCACTTTCCCGGGGCATGGTACTTCCAGTACCCACGGGACTCTCCTGTTAGCAGA
TCCATGGATCCAACATCCTCAGATCCACGGGATCCAGTGACCTGACAGACCTTAGGTGGATCTGCAGTGACCTCACCCTTGGTAGGCTCAAACCATCGAC
CATGTTGGCGCTTCTCCCAATAACCACGTGCCTCTCCCCTTTGTAGATCCAGGGTTGAAGAGACTTCGGATCTGGCAAACTCATCCACTTGGCGCAAACT
AGAGATCTTGGCAGCTGACACTTCATGTAGATCACGTGTATTATCGACTGGATCTAGGGTCCTGCTACCTGGATCTAGCGATGTCTTGTTCACAAATGCA
TAAATGCAGTACCTAGTCGTACCGGATTCAAACCCGGCGAGCGTCCTAGTTTAACATCTTCTCGGTCACTTCTGGCAACATCCCTCGGTGCTTGGCTGGA
TCAAACCATTGGCGGATCTGGTTGTAGAATTCTTCCATCGGACACTTGCCGACGTCCTGAATCTCGCCACACCCGCGACACACGTAGAAGCAATGATCTC
CGGGATGACCTTTCTTGCCACACTTCTCACAGACCAGATGTTTCCAGCATCCAGATTCAGTGTGCTTCCGGGATCCGCACTGCGAACACCTGACCTGGGC
TGTCCCGTCCATGAGATCTCGGAATCTGTACATCCCACGGTCCCCGGGTACGGTATCCCTCGGTCGAGAGTTGTCTCCGGTCTTCGCCGTTCGATCGTTG
GACGCAGTGAGACAGACTCGACGGTAATCTTCAGGGTCGGAGTCCGAACCGTCGGATCCTGACTCAGTTCCTGAGTCAGGCGCCGTGACTTGGTGGACAC
GTCGAGCTGGGGCCGTAGGCGTCGGAGCCATTTGGCGATACTTGCCGGATCCGACCGCCGCCTTCTTCTGGCGGTGTTTCGCGCGATCCACCGCCCGCAG
CACTTCCTCAAGCTCATCTGCGTCTGGAAGACGTAACAGGGTCAGCCTGTCGGCCAGATCCACGTCTCCCAACGTCTCGATGAAATGATCCACATGTTCC
CGCAGTACCTTGGATCCCCCATCCTTGATCTTCAACTTGGCTTGTAGACCGGCCACATTTAGTCGATGTAGGTATTTTAGCGGGGATTCATCCGATCTGC
GGCGAGCATGGTAGTATTGTCGTGCCACCGACACTCCCAATCAACAGTACTGGGTCTGGAAGCTGCGCAGCAAATCTGGCCACTTGTTCCTGGTGGATCT
GCCCAGCTGCCGATACCAGCTCCTGGCTGGCCCCGCTAGCAGATCCGCAAAGGTCAAACACTTCTCAGCATCCGACGCTTGATCGCTCATGAGGCCGACT
TGACTTTGCTGGTCCATGTTCTCGCTCGGTCCTCATCTCCTTCATTGCCCGCGACTCCTTCAGGTCCGA