Description :
From Genome Similarity Track
Location :
Scaffold_47:2406- 22017
Transcript NameFunction/comments
Phyke_g2378hypothetical protein
Phyke_g2379hypothetical protein
Phyke_g2380peroxisomal 2,4-dienoyl-CoA reductase, putative
Phyke_g2381hypothetical protein PHYSODRAFT_561893
Phyke_g2382hypothetical protein PITG_15639
Phyke_g2383hypothetical protein PHYSODRAFT_286543
Phyke_g2384hypothetical protein PHYSODRAFT_511790
Phyke_g2385GDP-L-fucose synthetase

Sequence
19611 bases(100 bases per row)
CAGCCAGGGAATCACCACCTAATTCGAAGAAGGATCGTGACATCAATCGCTCCTCGTAGCGAACGCtatcttcatcgtcaaagAGCTCAAGACTGAGTGC
TTGCACCCAAACTTGACGCAGGATGTCTGTAGCTAGCTGTATCGTGATCGCAGAGCTGTTGCTCGCAAGTCGAGGTTTATTTGAACCCGATGGACTGCCA
TCGCCGTTAGCACTGACCGAAGATGCAAGTGCGCGAAGATCAACCTTTCCGTTGGGTGTACGCGGCCATATTGTCACGACACGAAGCTGAGGCACCATAT
GCATCGGAAGGTGTTTGCTGAGATATGCACGTAGATCATCCAAGTCATTAAAATTGTTGGCAAGCATAACAAATCCAACAAGAGTTGAAGTCTGCCGCTG
CTTCTGACCAAGTGACTTTGCTTTAGAAATGACCACCTCGGCAGCCTTGACATACAGGTGGCGCAGTAGCACGTTTCGCACCTCTTGCAACTCGATACGC
ATCCCATGGTGCTTCACCTGTGCGTCCGTGCGGCCCAGGAATATCAAATCACCACTTGGAAGCCATTTTACCAAGTCGCCAGTCTTGTACAATCTCCTCC
CCTCGTGAAAAATGAACGTTTTTGCGGTGAGATCCGGACGGCGCCAATATCCTAttgcaacaccagcaccgccGATATATAGTTCGCCAGGTACATTTTC
TGGCACCTGCCGTCGCTGGGCGTCAAGCACGACCACTGGATGGCCATCAATGGGTCTTCCAATTGGCACGCTTTGGAGCCCTTCAAGGCTGCAAGAGCCA
GATTGCAGTACCATCTCTCGAGGTAGTTGGAAGGCGGTGGATGTTATCGATGCTTCCGTTGGTCCGTACTCATTGACCAAGCACGCGCTGCTTCCTTTGT
GTTTCAGGTAGAATTGACGGGCGAGTTCAATGGGATAATCTTCGCCTGCAAGCACAACGTGCCTAACTGAGGGTGGAAATGTGTCCTCCGACAAGAAATC
CACAATCAGCGCAAAGTACGATGGCACAAACACGCAAAATGTGATCCGGGGAGTTTGGAGCAGTACTTCGCGCATATAGTGCAAATCGTGTAACCCCTTT
GGGCGAGTGATACGTGCGCTGGCACCGACGAGCAACGGAGAAAAGAGCTGAGAGAGCGATCCGTCCAATGTAGTTGACGTGCTTTGGAGGAACACGTCGG
GCGGCGTCACGCCGTACGTGTGCACGGTCCACCAAAGTGTGGACATAAGAGCAGAATGAGGCACCACCACACCTTTCGGGTTGCCAGTGGACTACTCACC
ACAACATGCCAAAACACGTCAGTGAACAGTACTTCGTATTGGAAATGCGAAACACGTACGTACCCCTGACGTATACAGAATATATGCTGCGGCAGCATCT
GAATTCCGACGAAGGTTGCCTTGCAACTCGGTATTAGCAGTTGCAGCCTTGGACTTTGCACCGATGTCTATTGCGTCCGAAGACAAATCTCTCAAGTCTT
CGTAAAATACGACACGTGTCTTGAGATCATCATTATCTGATCCATCGCTCCTTGATGTGAACTCTGGAGCAACGAGTTTTGCGGCAGTGGCGGCATGTTT
TCGCTGCGTGATGATAATTTGAAGACCACTGTCGCGGGCCATATACCGCAGTCGCTCGCGTGGAAATTCTGTGTCGAGAGTCACAAACGCAGCTTTCGCG
CGCAAGGTTCCCACCATAGCTGCTACGTTCTCCAAACCTCGATCCAGTAGCAAGCCGACATGACACTCTCTGTCATTCTCAGTTATTTGAAGCTGATTAA
GAGCTTGTGCAACGCGCCCACTACATTCCCACAGTTCTTGGTACGTCCAAACTACACCTTCGAAGTGTAGCGCAACGTTCAATGGGGCCCTCTGCACTTG
ATAAAACAGGAATTCATCCAAAAATCCTGAAGGCTTCTTCATATCAACTGCACACGAAGCTCCAGGCTGAGGCATACCCCAGTCTGCAAGCTGTCGTTTC
TCGGATTCAGGAAGCATACTCAGAGCTGGCAAGTGCAACAAGAGGGTGGGTGAGCGAGTGACCTGCTCCAATAGCTCGAGGTAATACCCTGAAAACCGTT
CCACCGTTGTGCGTGAAAATCGAGCAGTTGGGTACTCCATGGACCCTTCCAGTACACGTTCCAGTGTGGCGTTGGGCAACCTAGACTTGAGATGTCGGTA
CCGCATAGATAGCATGATATCAAACTTTGCCGATTGATGCGGCAATGGTAGCTCCACGTATTCGCTGCTACTCGAATCATCGCAGGAATCTCTATTACTG
CTCTGCTCCCAAGAAAACATGACTTGAAAAAGCGGGTGTTGCCAACGTCGCTCGGTGTCGTCGTGAACCCCACGATTACTATGAGCTGAAGCACGCAAGT
GCTCTAGCATCTTATGAAACGGAATGTCCATGTGGTTGTACGCGCTGAGGACGACCTCACGCACATGCGCCAGGAACGTTTTAAAGTTTTTATCGCCGTT
GCATTGTCGGCCAAGACGCAGAGGAAGCGTGTTGACAAAATAGCCCATCACATCTTGTAGTTCAGTGAGCTCGCGTCCAGATGACGGAGCCCCAACGACA
AAATCCTGCTGGCTGGAAAGTCGCTCTATCAGCAGGTAAAATATTGCTAGCAGCCCCATAAACATGCTGGCGCCTTGAGCGTGACATAATTCCGAGAATG
CCTTCTGCAGAGAAGCAGACGATCTGAATACCACCACATCGCCCTTAACTGTGGTCGGTTCTGGTGCGCTAAGTTCTTCAGAAACTCCGCCGTTGCGTGT
GTGGGGCGTCTCTTTGTCGAAGGGAAGTTTGAGCAGTGATGGTCCACCGTCTTCTGTCAACTGCTGTATCCAGTATTGCAATGAGGATGCCATTACCCCG
GTACGCATTCTTGCGCGCTGCCAAGCCGTGAAATCCCGGTATGTTATACAGGAGTTACTCTCTAGCTGTCGTACGACTGCGTCTGAAGTGTCCTTGTTAC
GCAGGAATTGTGTGTAGAATTCGAGTAAATCATTCCAAAAAAGCTGACTGGAGGTTGCATCTGTCACAATATGATGCAGTGTCACGGCTAGTACCCACGG
TGATCGAGTGTTTTGTCCCGGAGCAACAAACGCGTAAACCCGAATGGGTGCTTGGCTGGCCAAAACGAACGGCTCGTCAATGATCTTCGCTACGAAGCCA
GCTAGTCTCGTATCGTCAGAAGGATCACTGCTGCATTGTGGCCGTTGCAATTCACACTCTACGATTTTGAGAACCGAGTGACTTTGAAAATACTGCAACG
GATGCACGTGCTGTCGCGGCTGTCCTCCAGCGTCGGTGTCAACATCAAAACATGTTCGCAGTGCCTCATGTTTTGTCATCAATGCGTCGCAAGTAAACTT
TAGCGCTGACAAGTCGAACATCACATCGGTGAAGTGCAATGCACGCACTACATTGTACGCTGTGCTTTCCGGTTGTAGTGCCTGCAATGCGaacatctgc
agctgtgaATACGACAACTCACAGCACGTGTTGCCATTTCTCAACGCTAGACCGGGACGAAGCGTCAATCTACCGTtgtcatcctcgtcctctgtATCGC
CGAGCATTTGCGTGACTGCTTGTTGGAGCGTCTTTAGTCGACGGATTCGTGTGCTTTTCGAGCTTGTTCTGCTCTTCGTTAGCTGCTCATTGTCGCCAGT
CGTTGtcaacagcaaaagctgcagccaaTATACCGCCACGTCCACTTGTCCGACATCGATCGCTCCGGATAATGCTTCAATCGCAGCATTGTTACTGGGT
TCACCTTCATGAGCAATGTCATCAGGCACTGATTGCATTCTGCAAGACACGGTCAGAAAGAGCTCAAATGGTCCAACAAAATGAGCAGCCGTTACGATGA
ActtcagccaatcaaaagcGAACTCGATTTTGGCCACGTCAGTTtttggtacactgtaccagttgaagttgtcttGTACTTGGCAACCATCAGGGCTCCA
CACAAAGGCCCTCACCAAGGACATGGACGTTCTACTTCAGGGAACGGACGTCTCAATTCAACCAGTACTCCTCTCCTGCAACACACCAGAAAGGTGCGTT
GAGGATTGATGGAGCGTTGCTCAAGTGTCGATGCATTCCGGTGCGTACCGATATCAGCACAGAGCACAAGCTCTCGCGATGctcgtggtgatggcatACA
CAGACGGTGGGCCAGCATCTGCGAGAGAAACCCAATATGGCGGCAAAGGAATGCATCAGCTCAGACAATTCAGCGCTGGTGGCGTCAATGGAGGTTCATC
GAGGAAAAACACGCGAGAGAGAAGCTACTGCACCTCTGGGGCCGAGTGGAACACCGAGCTGCGCGAAGCATTCAGGTCTGGAACGGGTTCCATTTGTACC
GCAGACGCGCGCCTGTCTTGGCACTCTTCAAATACTGCCGTTGCCACGGACATCTATGCCACCAGACAGTGTGCTGGTGCGCACACTGCTGGTTAAAGCG
ACTGTGCAAGCGGCAGCTGGACATCGCTGCTCGGCGTGTGCAGAATTGGTGGCGAGGAAAATATCATCCAgggaactggaagctgggGCAAGCATTTAAG
ATGCTCAAAAATGGAGAAACCCTGGATAGCATCGCAACTGCTACGCGAAACCTGGTGACATGCGTAAAACAATCGCCGGATTGGTGTGTTAAACGCCTTA
AGGCATCGATCGTGGCAGTCACGAGTGAATTCATTGGAAGTTTACCCCCAGTGAGTCTGCTGAATCAAttgctcaagctgctggcggtTTTAGGCTCGTA
TCCTACGCAGTTGGACGACACGGAGTCACAATTTGAGATCAACCTCGACATGATGGAAGCACTGTTGGATGTGCTCCAGTTATATCGAGCTGACCAGCAC
ACGGTGGAGCTGTCAGCGTACGTACTCATCCGCTGCCAGTACTTTCAGGAGCTACAGGCTACAATGGAGGAGGACCCCAGTAGTCAAGAACGCTTCAGTG
TCGTCAAGGACAGGTTTGACCGCGTAGCGACGATGCTCTCATTGAAGCGCGCCATTGAGTAGCCGTCCATGTTCACCGTCCATTGAATAGTTCGAAATAC
GAGCGGTGCATGAGGTCAAGCGTGGCTTAAACTCAGTTAAACTACGATCAAGATTCAATGAGCCGTTTACCAGTCGTGTGCAGTAAAGGGGCCATTTAGC
GTTCCTCGTTCATGAACTCTTCTTTGACGTTTAACTTGCTTTCGAAAACATACTTGTTTCTTCGTGAAGGAAGAaggctgaagcagaagcaactcACTAG
CATCAACCTAATATTACTGTAGTAATTCAGTTTCTGCAGTTTTCTGCATTCATATACGAGCCGCACGAGTCTTGAGAACAATACCCACACCTGGTttcgc
ttcaacttcttACAATTTGGAGTCAGCAGTGACGCGCgacttcttctccatcttcttaGACCAtccttcaagcagctcacgAGGCATCACTGGCTTCTTG
TACAAATAATGTCCTCCATCCACAATGAGCACGTCTCCCGACACAAAACTGCCCACAGGAGACACTAAATACAGCACCGCAGCGGCGATATCCGTCTTGG
CGCCCACACGTCCCACCGGAATGGTGCTCTTCATATACTCCTTCCTCGCCTCTGGATCTACATCTCCTCCCAGCTTGGCCGTCCCCGTGGTATCCGCAAT
AGGCCCAGGTGCCACACCAGTGACGCGGATGCCAAATTGTCCCCACTCAAGCGCTAAGGAGCGCGTGATGCTGTCCACCGCCGCTTTAGCCGCCGACGCG
TGCACTTGGTACCACGTCGCAGGCTTCTGCAGCGTGGCTGTGATGTTGATAATGCGTCCATCTCCGCTGTTTTTCAACGGCTCAAAGGCCGCTCGACTCA
TGTTGAATGTCCCAATGGCGTCGATCTCCATCACTGTGCGGAAGgcgttcgtcgtcatcttctccgctAGAGCCAGGAAGTTGCCAGCCGCAGAgttcac
cagcacgtccagcttCCCAAAGCgcttcaccacttgctgcaccGCCTGGTCTGCATTCTCAGCGGAGCGGACATCTCCCTGGATGAACATGGCGTGGCTC
GCAGGGACGCCACGTTCCTGCAGGAGGCTCATGGTGTCCTGGAGAGCACTCTCTCGACGGCCAAAGACAGCGACCTTGGCGCCGTATTCCGCCAACTTGA
CGGCGATCTCTTGGCCTATACCGGATCCACCGCCTGTGATGAGGGCCACACGACCTGCACATGCATCGCGACGGAAGACTTGGGCGATACTGGAGGAGTC
CATGGCAAAACAAGATGTGAGCTCTACAGAGTCGAATGGGGAATGAACCTTCAAGTTGCTCAGCGTTGATGTAAAAGGAAACCGGTTGAAAACCGGTACT
AAATAGTTGACGTGACGTTGAAGATTTCACTTGCGTTTTGTAAGGAATaaataacagcaacaaaaaacTGGTATACTGGTGGTTTCTTAGATCATGTACC
AATTTTATGGTACTATACCTGATCAGCTCTTTGTTGCGTCTCTTTTGCATCGCTCACCGCCGCAAGCGTTGTCTGGACGGAAGCAGTCGAGTGTAAGTGA
AGCTGAAGCGAGTGCATTGGCAGATCGGTCCCTTCTTGTCCTCCCCCCTTATCATTTCACGTCCGTAGTGGCTTCAGCTCACTCCTCACACTCACTCGAC
AGCCAGCAAAGCAGGTCAAGATGAGCGTCGTGGCAGCCTCACAGCCGCAAAAAAACTACTTGGTGGACAAGAAACCCTACTTCAAGCACTTTTACCCTAA
GGACGTAGCCATCTTGGCGGTGAGATCGGCGGCCATGCAGGGACTAATGGTCTTCAACGCTTACGTCGCGTCCCTGGACTTGGAGGACTCGGACTTGGAG
GACTCAAGTGAAGACGAATTCGAGGATGTGGACGCCGTTGCTAACGAGAAGGAGGAGTTTGTAGCCCCCTCCATGGAAGTGTTCAGTATTACCAGTGCCA
AGTCTTTCGGTAAGTCGCTTAGTATCACCACATACGTGCGCTCGCTCGAGGAGGTGGCACTGCGCTTGTTCCGTCCGCAGATCGTCAGCAAGCTCATCAA
AGGTACGAGCTCCTGGAGAAAACTGTTCTGTCATTGCCTAGAACTGTAGAATGACAATTATTGCATATGTGTGTATTGGCTGAGGCAGATATCAGCAAAT
CGGCGACACGCAAGTATGTGCGCACGTCGAGTCGACTCACTGCGGCGGCCCTGATGATCAAGACTGGTGTGCGCGCCAACATGCTGAGCCACCTGGCAAT
CTTCCTGGTTGAGGAGGTATGTTGTTGCCTTGATATACGAAGATTGCAATGCTATCGACTGTTTGGTCGCATTTCTTTTAGTGGAATTCAAGCTCACAAT
GTGTTGGCATCTTGCTGTGTTATGACTTTGGCAGACCCAGCAAATTGTCGTCATTCTCTATCGACGCTTCGTGTCAAGGAAAGGTGGCAAGAAATCCAAA
AACAACCTGCGGTCTATCGAGGAAGGCAACCAGAGCAGCGGcaatgaggaggaagaggactCTCTCTCGACGTTCATGTCTTCTATGGGACGCAACGCCT
CTCGCTCTGCCCTGGCCGTTATCACCGGCGGagtgggtgctgctgttggtacGGTTGTGCGGCCAGGTATTGGCACGATGATCGGCGGTACACTGGGCGA
TACCCTTGGGTACGTGCTGTTTTAGATGACAAAACACTACAGTAGCGGATGTGAATTTGTACTCCGGGCGACGATGGAAGGCCCATCAAGTAACTGCAAA
ATCAATGCTATACCAGACGCAACCAGAACTAGTATTCTTGCCTGCCATCAGGTGTGCTCATTAGGCCTCTTCCGTTTTTTAAAAACTGAACTTGAACATC
GTTGTTTTCCATTTTTGTCCCACAATTTTCGTGTGTTCTTCAGTTTGGCAACGCTGGTCATGCACGTTAAGCACAGCTTAAAATGGGTCATAGGCGAAAT
TTACACAAACGGTTCTTTTTTCCGCGTGACCTCAACTTTGTCGCTTGTCCGCAGTTCCGTGACAACTTCATATTCTTTACTACAGTTCTTTTGAGTATAC
TTTAAACAGATTCATCTTCCGTTTGACAATGCTGTATAACAGTATCATTCCGGAAAATAGGGCAACCCCTTGATTCCGCTCCGAAATTTACGCACGTGCC
CTCCAAGCGTGCGTTGAACAGCTCACTCAGCGAGAAGAGCGAAGAGCACACGCCTGCCTTCTGGCTCAGCGTCTGTCAGCACTCTTCCTGCCCCAAGTGC
CCCCTCTCCAGCCTCAGTCTTACCCCTCTCTTCAGGTTGCTCCTCTAACTATCTTTCCACCTGATTACGGCCATCATCGCGGGTCTCTAAACCACACAAA
GAACCTATGACCACGGCACCCAGGATGTACATGGAGACGGTTTCTCTCAACGATGACGCGCCTTCACAGACGTCAACGCAGGAGGCATCGACAGTGCTGG
ACGTGGACAGTCTGGAGTCGCAGTTCTCACAGCCGCCAGTGGTGAAGATCGTCAAGGACTCGTCGCCAGAGATCGCTCTGCCAGTGTCCGACAGCGATAG
CGATGAAGACCAGACCAAGGACAAGAATACGCTCTCTAATGAATTTCAAGGCCAGAATAACAGGAAGACCACGGATGACTCGGTCATGGTGGATGTGGAA
CACAAAGAAGCGTCCAGTACTAACGGCTTCAGCAGTCAGAATgggaaccagcagcagcatgtacTGCCCCCTCTGCGTGTGCTAACTCAGAAAATACCAA
TTGAGGAGAGGGACTATGTGGATACAAGTCTGTTCTCCCCTGAAGTGTCAAGACATGCCATGGAGGTGGCGCACCGCCGTGCCAAGGCTATCGCGAATGA
AGTGAAGGAGATGGTCGATCTGGAAGGTGAATTGGGAGTCGTCAACAAGACCAAGCTATCTCCAGCAGAGGCGGTTGGCATTATTAGCGGCGCTTTTGCA
AACTCACTGCAGCGAGCGAAGCAGATTGTTAAGCCTGGAACGAAGGAATACGATCTCCTGTCGGGGTCATCGCCGTCTGCTAACATGGCAAAGCTGGACG
ACCTAGATACGGATGGAGACGGACTGCAACTCTCACCTGATGCGTCTAATAGTGACGGAACACACTTTCGGACGCCGAAGATCAGACCTGCGCTCAAGCG
TATCTCGGCCTATTCGTCGGCTGCGCTAGATCCAGAGGAGAAGACTCCCAgtacgaagcagcagcagaagaaaggTCTCCAGTGGCACGAAGacgtgctg
gatgctgaCGAGGAGTTTTACAACGATGAAGGCGATGGTCAGGAAACACACTCGCTGATGAACTCGGGAGACGGAGACGGCAGTGGAAATAGCAATGGCA
GCCCTCGACCTCAACTGCTAAattacagcagcaagaatgACGGCCAGCTCACGCCTcgaagcaagaagaagcgcaaaaaacTGGTCAGGTCCATGATGCG
ACGGCTGACACCgcgcgagaaggaggagctaTATCGACAGCGACCAGACTTGATGATTGTGCCTAACTGGGCGCAGAAATACCGCGAGGAGCTGGCGGGT
GAGGACTCAACCCGCTGGAGTACTTGTCTGCTTGCACTCATTAcagcacttgctgtgctACTGATTGtgttcgtcctcctcatcgtgCGGCAACGCGCAG
CCGCAGTGTAGATGTGGCTAGGTAGTCCACATTAGAGAGAAGAGCGACCACGTGGGAAATGGCCGACTCgtatttttttgctgctgtatgTTTGTTCGAC
TTCAAGCCTTGCGCGCAGAGAGCAGAGATCAACGCCACCAGGACACAACTACAAACTCACATTCCATAATATTTACTGGGACGTCAGCGCGTTTTACTTT
TTATCTAGCCTTTTGTTGAGTCATGAACTGAGTTGCACGCTGCAAttgtcaacagcagcaatgattGAAAGTAATATATCTGTTGTAAAGGTCTGAATCC
AGACACGACATGAGCACCAAAAGCAAGGACACGTGAGTTAGCAAGAAAATCACGCATTCGGTGTATTTCTTGGGGGAGGTATCAATTCAACGTCGCGTAG
AGGGCCAATTAAAGCATGGCGGTGACAGCGATCAACTGACGGACATGTCCGCATTTTTCCATTGTCTACCCGCTCTTCTCCCTGTTCTCCTGTCATTGca
ttctcttcttcctctaCGCACGCGTAGTCCCCTTAGTTcgaggagcaacagcgagCGCCTAGTGGTGGCTGTAGTCGAACTTGCCGTTCGTGCGCTTCCA
GAAGTTActcttctccttgtcctcctggCTGGCGCCACGAGTGGGAAGAACGCCGCAAATCACGAGGGCCGCACTGCAATGAAAAAAGTCGTCAAGTTAA
CATTTTTTTAAGCTAATCATTCGTTGGAAAAGGAGGGCTGTAGCCAGACGTACACTCCGCCGATGAGGAAGGGCTGGAACATCGGGCGCTTGGCCTCGTA
CGCCACGAACTTGGTGAAGGGCAGCTTGTGCCATCTGACAGCTTTCTGTTCAACCATCGTGGATCTTACGCTTGCTTCCTTCctgtggcgatggcgatga
ctGTTGTGGCAGACTTTAAAGCAGAGGCCCAGAACGCTCGAAAAAAAGGGGGGAGAGCTCGGCTCCACAAACGAAACCTGTAGAAATAGATACTTAAATT
GTGAAATTGAATCATTCGGACTTAGCATGAAGGAAAACGGTATTCAAAGCGTACCGAACGATGGAAGCGTCCAATGCAAAACTGCACCTGTAGCAACACT
GCATTCATGGTGCTGGGGCTACAATCATCACCTTTGAATTTGAGAAGGCGGTGGAAAATGAGTCCACGATAATGCTATCGTATACTAAACCAACCACAGT
TTTCGAAGGAATAATGAAACACTATGAAGTGTCCTCTGCAAACCTCAGAAAAACATTGGTGCTTGAGAACTTCACGGCCTCTTGCAGTTGTCAATTGCAG
CGTGTTTCTTGGAGTAAGGACAGCTGAACATCCTTACTACATAATAGTACTCCGAGGAACACTGATCTACTCATGCAACGAGAGCACTTCAGAACATCAG
CAAGTAGTCAAAGCCTTTGAAAGCATGACGGTGAAGCCATATTGCCCAGTCCAGCATACTTCAAGTACGACATCTAGAGTCGGTAACAAGGGCTGCAGAA
ATCAAGGACTCGGCAGAAAAAGCCTATGGGCGCAACTCGATAGCGCCTGGCGGGAAGCACAATCTCCGCGACCCGTCCACAATGCCCGAAATCGTAACAC
GGCTCTCACCACCTGCACGTAATTCTGTCGACGTGCATCTATCCAGTTGACACCAACCAACCTGCCACCTGTACAGCAACTCCCTGTGACCTGAATAGAC
GACGTATGACGGCTCGCAAGACACCATTCAGATACAAAAACGATCACGCTTGAAACCTTTGATTTCACCGGAAGAACAGACGCGCGAGTCCATTACGGAT
GATTAAGCGGGATCAGACGATCGCAAACGGCCGGAGTCTAGATTTGGACTTTGCAGCGCTTCCTAAAGCACAGCTTAGTAGTCCTCGTCGCCTCCGCCGA
ACATGTCCATGCCGCCGCCGAGGTCCTGTATCATCAAATGACGGAAAAAGACACACACAACAGTAAGATTTCTGTACCAATAGCACCTTGGAAACACCTG
TAAACTCGTCACTtacagcctcctcctcctcttccttagccttctcttccttggcGTCAGGAGCAGCCTCGCCAGCGGCTCCGGCAGCGCCCGgggcagc
agcggcagcaccagccgaGGCACCGCCCGACGAGATGAGCTCAGCAATCTTGCCTTCCTTGGACAGCAGTCCCGAGAAGAGCGTGGGCCAGTACGGCTCC
ACCTCGTTGCCCGAGGCGTGCAGGATCTGGTTGATGGCCTCCGAGGTGATCTCGTGTTCACCGTCGAAGAGGATCATGGAGGCGTACGCCACGCACAGTT
CATCGTGCTGCTCCTTGCTGATCGTCGACATTCTTCCGCTTTTTGTGCTTTAGCTTTCGGCAAATAAATGCCCCGCCCAAAGCTGATGGTCGAGGGGCTA
TTGGTTGGCGGCGAGCTCGCGATGCAGCAGACATCGGTACTTGACCGGTATATCGGTATCAAAGGTTCCGACGTAATTACGCTTTTTCTTACGTAAAATA
CAAACCTAAGATCTATCATACTATTACCTAAGATAAAGCATCATTTCAAaccacatcaccatcgtTTGAATTGAAGCGCGCCTGGAAAGGCGACGAGTGC
GAAAGGAAAGCGGCACGATGCAGCGCCTTAGTGACAACACTAAGGCTACCAGCAAATGGGAAGCACGAGCATCATTTGATCCATTTCAAGCAGCGTCGAT
TGGGCTATCTCCAGACGCTAACGCCTCCGAAACGACCGAAATATCGACACTACAGACTGACGACGGGAAAGAGAACCGTAGACCATCTACAGGTCGCAAT
TGGGACCATCCGAACGTCACAATGAGTCGCGGAGGTCACCAGACGCCTGTGGTAGACACTTTGCTGCCTCCAGACTCGAGTTTCGGCGAATCAGTGACCA
GTTCTTTGCTGGGGAAGAGACCCAAGTCGACACTACATAAAGCCGTCTTtgaggacgatgacagcaCTACAGACAGATACAGAGAtgcattggcagcagc
taATGTTGTTACACACTTTGAGGCGCGTGCACAGGAGCTGCACGGCGTCTCCGCGGCGTTGGGACTGGAGGAACCAGtgaacgaagacgaggaagagggG
ACTGCGACGCTCGTGGTCGATGATTTCTCACGTGTCGCTCAGCTGCGCTTTGGCTCTGTGCCATTTGGGGAGAGAAAGAGTTTGCAGCTGACACTGGAGA
ATCCAAGTGAATTGGGCAATGCACGTGTTAAGTATGAAGGATACGCGGTGGTGAGAAACGACGATGTTCCGGAGGCACCGCTCACCAAGACGAGGTTTAA
GTGTGATCTCCACGTGTGTGTTGTGGACGCATTAAAGTCTATGACGTTGCGCGTCACGTTTGAACCGCTGGCGGTGGATGTCGGACGAGAGATCACAGTC
ATGCTCAAGTTCACAGTTAATGATCGATTTAAACTGCAGTGCAAGGCGACAGGATCCGTGACACCACGTGCTGCTAGGCTATCCAAGCTCGGACGTCTTC
GAAAGGCACAGTCCACTGCACAATCCACTGATACGATTACAGTGACATCGAACACGAGACAGCATTTGCCGCCGCGTATCGAATCAATGCAACGACCCAA
ACACCCCAGACAGCAGCCTAACCGAAGAGCAGCTGATCCAAGAAATGCAGCATTCACAATATCAAGTGTCTTGGCGCCGAGAGAACGCAGCCCTGGCGAT
GAAGATCTTGTGGCCAACCCGAGGGTGGGGGATAAGCGCCGCACAGCGCTTGCTATAGAAATATCACCCCCACGAAATGGTCTAAAAAGACAGCGCACGA
GCATGGCAAAAGCACAGACCCCAAGAAAAAATCTTGGTACCGGCCAAGAATCTTCAGGTGCGGCCACTTCCCCGAAGAAACCGTTTTCAGGGTCATggtg
gaagcagcggcaAGAGATTTACGATGAGAACTGGATGACAAAACAGAGCGCGGGTTTCACAAAGTGGATGAATTACGTTTTATTAGACGGCACTGCTCAG
CGTCTGAGAGAAAgcagcgaggaagacgatggtgaGCACCAAATTGGTGGGGTAAAGCGCAGGTTTGACTTCTCTTCGCTCCGTGTGCTCGCACAAAAGC
GCATGGAGTCTGGATGGGCACAAGCAGCCGTAGAGTTGTATCACTCGCCGGACATGGACGATATCTTCTTCAATCTGCAGGACGAAATCGGCAACAAAGG
GCTTCTTTTCCGCGCAGACCGCCCAGTGTATGCTGACGTCGGGTTGCAGGAGGAGCTTATCAGCCTGCTCAATAACTACCACCCGGTGTGGCTTTGCTTG
GGCTTGCATGCAGTTCTTGGGCATCAAGtcatgaaggaggagaaatGCTCTCTGCGGGCAATTTTCACCGCAACCACGGTTAAGACATCTATTCGgggga
agaagatgacatCATCAGATCAAAAGATGCCGCGCGTGCTCCGTCGAATCATTTTGAAGCATTTGGTCAAGGATTCGCAGGTGGCAAAGAACTATCGTTC
GGTCAAAAATCTGTTGACACCATTGGACGGCTCCACAGCGGACCGTAATGACGGTGGAAATGCTTTCAGGAGTACGAAGAGGAACATCAACGGCCGAGAG
TACTTTGACTCGTTGACAGAGACATTCATGCTCAAGTTCTTCATGCTAGTTCTCTTTCTTGATCGCGCGATCGAGTACAAGGCGAGTAAGTTTGCTCATT
TCCCCTGTCTGTTTCGAATTGTGGCTACAacgaacagcaagagcaccCCGAGTTTAACTCATCGGAACAACAAgagtggtgatgatgacaatgtGAAAGT
GAAAAACTCTCAGGTGTTTGTGACAGAATTTTGCAGGTTCTTCCTGGCAAGCGAAGGTCGCATTGACAAACATCTTAAACAGCTAGGTTATGCATTGAAG
CATGAACAAACAGCACTGGACGAGATCGATTTGGAGATCAAAAATTGGGAAACTGATCTACGTGATGGCGTCCGCCTAGCGAAACTTATGGAAGCTCTCA
CGGCGCCCGTGTCGCCCTCCTCTAGTCAAGATGGGGAAATTGGGCCTACACCAAAAGGATTGTCAACCTATTTACGCGTGCCAGCTCTGTCGCGATTGCA
GAAGGTGCATAACGTCGAGATCTGCCTGCATTTCTTGCAAGATAAGTGCGGCCCAAGCGTACTGGATAACATTAAAAGTAATGGTGGTAAGACCGACAAG
AAACGCCGGCTAAGTGGACGCGTGCGCGTATCATCGTCTGGATTTGCAGGTCTTCGCAACAAAGTGGACGAGAAAATGGTGGAAAACTTGGCTAAAGACA
TCGTGAATGGGCATCGTGAGAAGACACTGGCCTTGCTTTGGAAGCTCATCAGCTCCTTCCAATTGCAATCACTTGTCGACGCACAAACCATGAAGAAGGA
AATCGACAACGTCGTCAAACGGATGAGTTTCCGTGCTAAAGAATTCTATGATATTGAGCAACAGAAAGCTCCTGTCTCCCACAGTGATGAGCACGAATGC
TATGGGTTGTTACTGGAATGGTGTCGCGCCGTCTGCGCCAACTACACTGTTAGTGTGAGCGACTTCTCTACTTCGTTTGCTGACGGCAAAGCGCTATGCT
ACCTTTTACATTACTATCATCCAATGCTGCTGACGAAGGCGGATATGTTACCGACAATCAGTGACTTATTTGAGGGGCGAGAGGTTCAAGAGACCAGGGA
AAGTGTACTCTTGGCaaatgaacagcagcactttgctcTCGTAAACGAGCGTATCAAGCAGCTTGGAGAAGTCCCCGTACTGATGCCGCAGCAGTACAAC
ACGAAAAACCCGCCTGAAGAGAAGATGGTAGTGACTTTCGTTTGTTACTTGCAGTCACGTCTAATGGATTCGTACAGTGAAATTCATGCCGCGTCGAGAC
TGAAGCGCTGGTGGATGAGTCCGTACATCCGCTTGCGGATGCATCGGAAAAAGAATGCTAGCGCCCGTATTATTCAGCGATTCTGGTACACTTCCAGCCA
GAAGCGGCTGGCTATTCGGCAATGCCGCAAGCTATTGCGAGCAGCATACCTCGTCAAAAGTACGGTACAAACGTGGGTGACTAGGAGATACTTCCTTCGC
TTGAGGAACTCCGTGGTGGCTATTCAACGGGCTTTCTGTGCCAAGCGGGAGCAACGTATCAACGGGCATTCAATCGACACTGTTCGTGTAATTCAGTACC
ATTGgcgcaagcagctcaagtggAGACGGGAGAAGGAGCGGCAAGTGGAGAAGGCTATGCAGCGCAAAATCACACAGCGTGTGCGCATGAGGACGAGTAT
CGCTGTCATCGAAAGAAACTGGTTACAGTATCTATCCCGAGAGGGAGCTCGTCTCGTACGACAGCAAATGATAGCAGATCGGAAACTGGCTGTATCCCGG
ATTCAAATTGCGTGGCGGCAGCGTCATATAGCTGTCGAAGCAAGGAGACGGCGAATGAAGGCGTGGCAACAAGCGCACCTTGTGGCGCGGGCTATTCAGC
GGGCTTGGTCCAcattccagcaccaccgcgaAGAATGTCAGCGAGTTGCAGCTTTGCAGCGGTTTGAGCTGATGCTCAAGGAAAAGGAGCTCGAGAAGAG
AAAGCTAACGCTGAAGCGCAAGGTGGAAACTCATGCCGCCAAGTGCGTTCAAAAAAGTTTCCGTAAGTTTGCATTGCATAAACGAACAGTGGCTGCGACC
AAGTTGGCGAGTGTTTTCCGTTGCACGAAGCAGAAAACGACATTTCAGAAGGAGAAGCGTGCCGCAGTCCTGCTTCAGCGGAACGTCCGTGTGTGGCGTC
AGAGACGACAACTTACGGCGCTAACTCAATTCTATGGTATGTTCAAGACTTACAGGTTGATGAAGGCAAGCCAAGCTCAGCGACGACAAATGCGTTTGCA
GGAGCTCAAACGCACTGTGGAGttgcgtgctgcttgctgtaTTCAAGACGTTTTCCGTAGGTACAGGCTCCAGAAGCAGGAGCATTCTGCGACAAAGATA
CAATTTTTGATGCAATCTTGGCTGCAGAGAAATCGGTATACCGCTCTCCGTCGGAGCGTATGCGTACTCCAACGGAATGTTCGGGTCTGGCGCcgccaga
agcagcttcgtgcgttgctggtgttccGACGCATGCTATTGTGCTATCGACAAATGCAACgtgaggagcaggagcaacaggagagGGAACGGCAAAAGCG
GCTTCGACGGCTACAGGAGAGTGTTGAGCACCGTGCAGCCTACCGTATCCAGATACTGTTTCGCTCccatcttcatcagaagCGAATGCTTGCGGTCACG
CTTATTCAGTCAGCTTTCCGTGGGTTTAAGGAACAGCACAGGTATTCGAAGACGCAGGTTAGCGTTGTGAAGGTCCAGCGCGCCGTTCGCTCGTGGGCTG
CGGTAACGAGATTCCGACAAGCAATGTATTGGCACCGCGCAGCTGTTAATATTCAGAAATATGCCCGCGGATGGATCTCGCGCCGTCATCGGTTTAACTT
TTACGGTCTGCAGActcagctgcagcgattgcGCGTTCTAACGTCATGCTGGAAAATTGAGTACTGGTTTGCCAATCGCATGGCACGGTATCAAAAGAAA
CGAGCTTACTGCGCGCGAGCTCGCTGGACTCAACTCCGTGCAGGAATCGTGAGGAAACGTCTCGCAGATGTAAGCAAAATTGTAGTCTGCTGGCGGGCGT
ACCACATGAGGAGCGTCATTGATGCACGAATTCAGCGGAATCGAAAGATGGACACCGCAGCTCAATGCGTGCAGGTGTGGTGGTTGGGACTATGCTGTAA
GTGGGCAGAGCGTCATAGGcgggaagaagaacagcggCAGCGCGAACTGGAAGCGATGGCCTTGACGATGGCGAAGGCTCGAGCAATACGTATTCTAGGC
CCGTGGCTTTGCGGGAAGGTTATCGTGCCTTTTAGGGAGCGCAATATTCACTACGTCTCGGTGCGAAAGGTGCAGGCATGGTGGCGTGGAACGCTGGTTC
GTTTGCATCACAGCACACCCGAGGTCgtgaagcagcgcaagaagctATTAACGATGAAATTGGTGGGGCAGGAGAGGCACACTGGCGTAAGTACAGCGAC
GAGTGGTCCGCGCAGGGTCAAGATGCACCAGGAGAGTAGGACCGAAAAACATCAACCGCAGACGCTTGGTGCTCGGCTAGAAATGGCCCTCCACATGCTT
CTACATGGCAAGCGACTGCAAGATATGCTTTTTGCTAGCCATACGATTGAGGTGTGCACGCGATACTCGCGTGaatgctgcaagaagtgTGTTCAACTCC
AGATCTCGTCCACAATTTTCGCAGCGATTCGCGGTCTTAACCGCAGCCGCCCACATGTCGAACTTCTGCACCAGCTACTGCTTGTTTTGGTAAACCTGAC
GACGTATCGGCGGTCGACAGGGAAAAACAAACAAAGGCCGGTGTTGTCCACTGAGGATACCGACGGCCGTCTCCAGGAAGATCTACGCGCTTTGGACACA
CTGGTGGACCTGCTGCACATCCACCGTGACATGCACCACGTCTTCGTTCTATCATCACGGGTTATCAAGTATTATCTGAAGGCACTGAGTCCTTTGGTCG
ACTGGAATGACGACGTTCTAGAGAGCTGGAGCGAAGCCAAGAAGCGACTAGGCGGTCTACAGGAGTTGTTGTCCAGGAGACTAGCTCTATACACAGCAAC
TGCCTCGTTTAGGTCCCTGACGCAGAAATATACGgaaagaagcagctcaagcaacCTCATGAAGAAAATGAACCCGAAAGAGGCACTTTCGATCATGACG
CAGCTAGTGACGCTGTTGGAACGGGAAGACTAGGAGTAAAATGGCGGCAATTAGCTTCCGTTAGGGTTGTACACGACGTCAAAATTAATAGTATGAATCT
GCATCAGTGGAAACACTTCTACGTGACTACACACTTCGCCCGCTTACTTGCTTACTTCCGTGCGGTCTCGTAGTTGGCTTCGAACCAGGCAGTTGTTTCT
TGCAGTCCCTTGGCGATGGGGGTGAATTGGAAATCAGGCAGCAAACGGCACAACTTAATGTTGCTGGCTGTCTTCTTGAACTGTCCATCAGCTTTACTCG
TGTCGAACACAATTTCACCTCGGAAGTCCATGGCAGTAGCGATCTCGCGTGCGATATCTCCGATTGAcacttcgtcctcctcgccAACGGACAGGATGAG
CGGCTCTACACTATCATAGTGGTCCAGTGTCCACAACATCAGTCTAGCCACGTCATGGCTGGAAATGAACTGCCTCAGGGGTTTGCCACTGCCCCAGATC
GTCAATGGCGTGCCATCTCTCTTGGCTACGTAGCACTTGTGGATGAGTCCAGGCACCACATGACCGTCGTCGATATTGAAGTTGTCGTATGGTCCATAGA
TATTGGTCGGAATGACTGACGTAAAGTTGCATCCAAATTGATCCGCATAGCAGCGGTTCAGTGTGTCAATGAGTCTCTTGGCCATTGCATAACCTTCGTT
AGAGGCATGAGCTCTCCCATTGTGCAGCATGGTCTCATCCAGAGGGTATGACGTATCGGCAGGGAAGACGCACGTAGACAGACAGGACACGAGCTTCTGC
ACTCCAAACTGCTGACAGCACTGCAACACCGAGTCGTTGATGGCCATATTCTCTCTGAAGAAGTCCACTTTTCGTGATAAATTGTGGAAAAGTCCACCAA
CAAGCGCCGCCAAATGCAACACATGAGAGGGTTTAAGACGTTCGAATAGTGCTTTGGTCTGGGCGGCGTCTCGCAGGTCTGCGTCTTTGGAGCCCACAAA
GTGCCACTCATCTTGATCAGAGGGatcagcagctacgacgTCTTGCAGCGCGCGACCTACGAGCCCTGTGCCGCCCGTGACGAGCACCACGCGATGAGGC
TTCGGCTCGCA