Description :
From Genome Similarity Track
Location :
Scaffold_328:24059- 26873
Sequence
2814 bases(100 bases per row)
GAGACTCTACGACTCTAGAAGTCTTCCTCTGACAAAGGAGTAAGGGTAGCTCCGCTACACTTGGTAGCATATGTAGTCAATCATCACCTGAGTCTGTTAA
AGACTGTCCCTCTGTAAGGATGTAAACAAAGATAAACCTCTCTGAGGCACAAAGATTAGCGCTAGAGAAACTAAGAGCGCTAGTGGGGAACAAACATGTG
AATTTAATCCTCACACAAGGTCCTGACGTGATTAGTGCACGTCTTGACGCTTTTATGCAGTTTGAGTCTACTTTGATTGGTTAATTACACGACTCTGTCA
TCGACTATGCCTACTCGGTATGTTCCCGTACCTGATGAATAACCAAGGGCTCGCCCCCTTGTCTTGACTGTAAAGCCATTTGAGGGAAAAGAAGGGGAGA
ATCTTCTCCTGTGGATTAGAGAGGTAATGATGGCCATGATTCCGCTATGCTCCGGTCGGAGCAACAGCGAGTTGGGATGGCTATCTCAAAATTAGGTGGT
CGAGCCAGAGAATGGGCTCTCACATGTGGCACGTCGGTAGACGAGGCTTTCCCCACATGGGTGTGCTAAAACAGCAAATATCCCGGGTGTTTGCTCCGAC
TAATCAGGCATACCGGGTGCGTTCTCGTTTCCTATCTGCCCGTCAGGGCAAGAAAGAACTATCGGACTATGTCCAGGAACTGAGAAGTCTAATCGCTGCC
ATGCAGCTTGATCCCTTTCCAGAAATGGTTTTGGTTACCATCTTCATGGAGGGCGTTCGCACGGCGTGGCTCGAACAGAAGTATTCCGGTACACCCCACC
TCCTTTGAGGCGGCTGTGGATATCTCGTTCAACACTGAATTCAACTTATAGGCAGCCCGTTTTGGCACCCATGGGTACAACTCAAACTCGGCGAAATCCT
TTAGTTCACTTAATAGGCCGAAGCCTATGGACCTCAGTCTCGCCGAGACGGACGAAGAAGCAGAGCTTCGAGCTATAGAACAGTATCGAAACATTCGGCG
ATGTTTCACGTGCGGAAGCACAAAAAATCTGCAACCTAATTGCCCTTTACACAGTGCACGCCAGGATACTTCAGGCCGAACTCCCGCCGCTAACCAGAAG
TCTGGTACGGTGCGGATAAACTTAAACTCCCAGTAGGCGCGGGGCGCCCTGCTGGGGAAGAACTAGGTTCGGTTGAGCCTCTACAGGTGGTGGCGAGCAG
AATTTAGCCCGAAGGAGTTCCGTGTGCGATAACACGGGGCGTGAGTACAAGCCAGGTTTGTTGGTCGCAAAGGGACTGTTAAGGGCTTTGACGAAACCTG
GTCGATTTTGATCGACTACGGTGCATCCGGTAATTACGTCAGTAGATGTTTCGCTGAAGGGAATCCACGCTATGTTGAGGTGCTAGAAGCGCACAAGGGT
GATACGATCACTGTTCGCTTAGCGTCAGGAAATCTAGTCACTGCACCCAAAGTTCCTGTGAACTTGGGTGTGAAGTTTTTCGATTTTGATAGTATCAAAC
GCTGTTTAGTCCTTGATTTGGACTCGAGATATGACCTCATTCTTGGTATGGCTTGGCTTGGCTTGAGCGCCATGATCCATGGATCGACTGGAGGTCGAAA
ACATTAGGCGCTACGCGCACTGCCCCTAGCGGAGCTTTGGAGAGTCATGATCCCACCTCTGCTAGGAATCAGGAGCGTTATTGGTGCGCGCCACTGGCTG
ACTGATAATGTCAGTGTGCTGGACATCGGAATGTCAGAGTTAGTTGATTCTGACGATTTCAAAGACATGAGTATAGAACTAAGCTCGATATGTGATAGTG
AAGCGGCACGTACTCCGCTAAGTGATAGTCGCTGTGAGAGGCAACGTACTGAGTGATGAAAGCATTGTTGACCAAGCGTCAAGTCATCGAGGGCTGAACC
CATCCGATGAGCGTGGAGTGGCACGTAAGTACCCACTGAGTGACGTTGGCAGTGATAGCGACGCGCTGAATGTCAATATTGACGTTGTTGGTTCAATACT
AAGGCATCCCGAGCCCGGCTCAGCGGATACACATGGAGTAGCACGTAATCCACGTGGTGACGACGTCATGCTTAATGACTCGTCATCGGATGTCAATAGC
GACGTCAGCTCTAGTTTAGAGCAAATTACGTTCGATGCTGAGAGAGATACGAATCACACATCGTGTGCTGTGTCACAAAGTGATGATGACTGTCAGCTGT
ATACACTCGTCAACGGAGTGACTGGTGCCTGTGATGGTACAATTAGCCTTGAGGCTATACCCTCGTTAAGTTCGCTTTTAGAACTCGGAGAGTTGTCGGT
CGATGAGTTTGATCACTGATTAAAAAATGGAGACCTTTCAGAGGTGGTGGTCATTTGAATCTACATCATAGAGTTGAAATCTTCTTTACTTTTGGATGAA
GCCGTTCTGGAGTACACAAAAGCAGAACTCAGTGCGCGTATTGGGTCATCAATATTGAAAGACCCTCATGATCCCTTTCATTCCTTTGTCAAGCAATTTC
AAGATGTGGTGTGCCACGATCCACCCTCTGTTCTACCAGATAGAGGTGTCGTTCATGAAATTGACTTAGTTCTTGCGATTAAATATTGTGTCACACGACA
GTGGCCCTTGTCTAAGTAGCAATATGATGTCATTGATGACTTCTTCCGTGCCAAGCACGAGGCAGGAATGGTGCGTGAGAGTAAATCTCCACATTCGACA
CCGACATTTTGTGTCAAAAAGACGAACGGCAAGCGGCGTAATGTGCATGCTTATAACAAGCTTAATGCGGCTACTATTCCGGCACAGACACCTGTTCCCT
ATAAAGGATGTTCT