Description :
From Genome Similarity Track
Location :
Scaffold_3:2405186- 2407041
Sequence
1855 bases(100 bases per row)
ATTACCGTTTAGATAACGCTTAAAAAAATGTCGAAGTTTGGCCACCTGGTCCGTCTTGCAAAATTCGTGGTGAAGATGTAAAATTTGAAAATATTTCGCT
GGGATGTCAATTTTACATGAAATGTTGTAGAGATGTAGCGCGTGTGATTTTCTATTGAACGGTGCCACGTAGAGTGCTTAAATATCCCCAAGGGTCTGGT
TTGCAGCAGCCGACAACAACAACAGCATTTGTATGGGCGTTGTTAGGCGAGATACGACAGTATTATCAAATGACTTATGTTTGTAAACATCTTGCTTATA
TTTTTGGACACGGTTTAAACAGATGCCCCGCTTATATTTCCCGATGGAAGAAGTACCTTTTTATTCACATAACCAGAAATTACCAATTATAAGTACCGTA
TCGTCTTAGTAATAGGCCTAAGCGACAGACCTCTTTAGCCAATAGGATGATCTGAAAAAAAACAGAAGGTGAAAATTAACGGTCAGCTAATTTTAAGTAT
TTTAGAAACCAATTCGTTCCTGCACACTTGAATCAGGATGGCACGGCCAACCATCAAGGGCACGAAAAAGAAGCGCAAACAAAACAAGCGAGTTTGTGTT
GAGTATGGCCACAAGCAGGAGATTATCACCTACTTACAAGCAGGCCATACGCTTAGTGAAGCTTTGGACTAATTATACGGTACTTTGACCGGCAAGGAGC
GACGATCAAAGCAGCAATTTATAAAGAAATGGCGTGGTAACGATGCGACGATAAAATCGGCTTGCGAGAGCGGACATTCACGCCACCTCAACCTTCGTGA
GCGTGGCACAACAACAGTGTTATCTAAAGAGGCTGAAGAAGACATTGCTATGTGGATCAGCTCTCTTAGAAAGGACGGCGCGCCGGTGTCCCACACGATG
ATGAAACTTAATTGTTTGGAGGTGGAAGAGGACTGTGGGCTTACAATAGATCGGTTTTCGGCGCCCCGTCGTGGATAAAGCTGTTTATGCGCCGCCATAA
GCTGTCTCTACGATCCAAGACGCGCCAAGGGCAAACAACCCCTGAAGACGCAGCACAAGTCTTCAAAGAATTTAGGTGAAAGGTACTGCAAACAATTGTT
GAACAAAAATGTGTCCACGTATTTAATGCGGACCAAACGGGTAAGTTTGAAACTGTATTTTTCTTATTTTTTGTTTTCATAATATAACAACGTTTTCGCT
TAATGTAGCCATTTTTTTAGTACGTTCCTAAACGAGCAATTACAGATAAGAAACGAAGACGGTTTGGATTCGTTGCGGAAATAAGGACAAACAAAGGGCG
ACAGCTACGTTACTTGGCGACTCAAGTGAAAACAAATTTGACACTTTTGTTTTGTTCAAAGCCGCACCGTCCAAACCACAAGGCAAGCAGAAAGAAAATG
ACAACTTGCGAAACTGGTTTGGTACAGCAGCTTGGCGCGAAATCAAAATACTTCAGGATAAGTATCCCTGTAGAATTTACGGCAACAACACGGCATGGTG
GAACGAGAAGCTTTCGATCAATTTTTTGGAGTATCATTTCGCTTACCGTGAAAATCGTCACGAAAATGTTTTTTTACTATGGGACGACTTTAGCGCACAT
TGGACTCAGACCGTTCGTGATTTTGCAGCCTCTCTAAATGCTGTTCTGCTCAAGGTGCCCCCCAAGTATTATTATGTGTGTCAGCCTGCTCACATCTCGT
GGAATAAACCGTTTAAAGGTGAGCTTCGCGCACTGTGGATTGATTCTATTAGACAGCAGCTACATACAACAGCGGTGAGCCAGAGCAAGTTCAGCGCAAA
AAACAAAATTAAAGATGAAATTTTGCTTGCTCATACAAAACTTGATCAAGAAAAT