Description :
From Genome Similarity Track
Location :
contig_33:240465- 241513
Transcript NameFunction/comments
g7646.t1hypothetical protein

Sequence
1048 bases(100 bases per row)
TAAGCGCGAGAACAAGCCCCCGCACGTTTACGCCGTGTCCATGGAGGCGTTTTTCAATATGCGGCAAAAGCAGGAAAATCAGAGCATTTTAGTCTCGGGG
GAGTCGGGAGCCGGCAAGACCGAGACTACAAAGATCGTCATGAGCCACTTGGCGGCGCTGGCCACCAATTCCAACTCCAAGGTCATCCAGCAGATCATCC
AGGCCAACCCGCTGCTCGAGTCGTTCGGTAACGCCAAGACTGTGCGCAACGACAATTCCAGTCGCTTTGGCAAATTCACCGAGCTGCAGTTCACGATCGA
GGGCCAATTGATCGGCGCCAGGTCCCGCACGTACCTGCTGGAGAAGAGCCGCGTGACGACGCAGGCCCAGGGAGAACGCAACTTCCACATCTTCTACCAG
CTGCTGGCGCAGCGCAAGAACTTCCCGGAGCTCGAGCTCGACATGGTGGACTCGTTCAAGTACGTGTCGTTCCAGGCACAAGCCCCCGGCGGAGACGAAG
AAGGCGACCTGAGCCGCACACGAGAGGCTCTGGAGCTTGTGGGCATTGAACAGCCATTGCAGCAGGAGATTATTCAGATTCTGGGCGCCGTGCTGCATTT
GGGAGAAACGGCGTTCACGACCCGCAACGGAGACGTGGATGCGTCGCAATTGGTGGATCTCAAGCACTTTAGCGTGGCCTGTCGCCTTCTGGGCGTGGAG
GTCGAGGCGCTGGAGCGCGCGGTGTGCAACCGAAACGTGTTTGTGGGTCGCGAAGTGATTCTGAAGCCCATGACGCACGACCAGGCGGCGGATTGCCGTG
ACGCTCTGGCGAAAAGCCTGTACTCGAAGCTGTTCCTGTGGCTTGTGGAGCAAATTAACCAAACTATTGGTGTCAAGGTGAAGGGCGCTGGATCATTTAT
TGGCATCCTGGATATCTTTGGTTTCGAGCACTTTGAGACGAACTCGTTTGAACAGTTTTGCATCAATTATGCCAACGAGAAACTGCAGCAGAAGTTCGTG
CAGGACGTGCTGAAGACGGTGCAAATCGAGTACGAAGAGGAAAACATC