Description :
From Genome Similarity Track
Location :
contig_33:240453- 241516
Transcript NameFunction/comments
g8013.t1hypothetical protein

Sequence
1063 bases(100 bases per row)
GAAATTCAGCGATGGCAAGCGCGAGAACAAGCCCCCGCACGTTTACGCCGTGTCCATGGAGGCGTTTTTCAATATGCGGCAAAAGCAGGAAAATCAGAGC
ATTTTAGTCTCGGGGGAGTCGGGAGCCGGCAAGACCGAGACTACAAAGATCGTCATGAGCCACTTGGCGGCGCTGGCCACCAATTCCAACTCCAAGGTCA
TCCAGCAGATCATCCAGGCCAACCCGCTGCTCGAGTCGTTCGGTAACGCTAAGACTGTGCGCAACGACAATTCCAGTCGCTTTGGCAAATTCACCGAGCT
GCAGTTCACGATCGAGGGCCAATTGATCGGCGCCAGGTCCCGCACGTACCTGCTGGAGAAGAGCCGCGTGACGACGCAGGCCCAGGGAGAACGCAACTTC
CACATCTTCTACCAGCTGCTGGCGCAGCGCAAGAACTTCCCGGAGCTCGAGCTCGACATGGTGGACTCGTTCAAGTACGTGTCGTTCCAGGCACAAGCCC
CCGGCGGAGACGAAGAAGGCGACCTGAGCCGCACACGAGAGGCTCTGGAGCTTGTGGGCATTGAACAGCCATTGCAGCAGGAGATTATTCAGATTCTGGG
CGCCGTGCTGCATTTGGGAGAAACGGCGTTCACGACCCGCAACGGAGACGTGGATGCGTCGCAATTGGTGGATCTCAAGCACTTTAGCGTGGCCTGTCGC
CTTCTGGGTGTGGAGGTCGAGGCGCTGGAGCGCGCGGTGTGCAACCGAAACGTGTTTGTGGGTCGCGAAGTGATTCTGAAGCCCATGACGCACGACCAGG
CGGCGGATTGCCGTGACGCTCTGGCGAAAAGCCTGTACTCGAAGCTGTTCCTGTGGCTTGTGGAGCAAATTAACCAAACTATTGGTGTCAAGGTGAAGGG
CGCTGGATCATTTATTGGCATCCTGGATATCTTTGGTTTCGAGCACTTTGAGACGAACTCGTTTGAACAGTTTTGCATCAATTATGCCAACGAGAAACTG
CAGCAGAAGTTCGTGCAGGACGTGCTGAAGACGGTGCAAATCGAGTACGAAGAGGAAAACATC