Description :
From Genome Similarity Track
Location :
Scaffold_1268:2404- 9317
Transcript NameFunction/comments
Phyag_g10111hypothetical protein
Phyag_g10112conserved hypothetical protein
Phyag_g10113hypothetical protein PHYSODRAFT_472429

Sequence
6913 bases(100 bases per row)
GGACACCCGCTTGTCGAAGACGCAGATTCCGGACCAACGACTCCCACAGCTCGACCGACCTCCTTCGCCTTGCTTGGCCAACGTTTCGTGTGGAGCGCGT
TTATCTTCACTCGATTGGTCTACGACCAAGTGGTGCAGGATGAAATGAAGCCGGCTCGCCGAATTCCTagtgctgttgatgctgcgtTCGCCCTATTTGG
CAACAATGAGGGAGCTATGGAGGTTGCTCGTCGTATGGAGGCAGATGCGTCTGGATCTGACGCTGGGAACGGTGTAGACATGGGATTCGTGCCCCACCGA
GACGGAATTCAATTCGCGTCGAACCTGATTACTCTACGCCAAGTAATCGATGAGGAGTTTAACGATGACGCCTCAGGTCCTGCAAATGCCAACGCAAGTA
TCAGCACCTTGTGGCTTCGAGCACTTCGAGCGCTGTCAAGAGCGTCTCCAAATGCCGCTAGCGTGTTCCACTCAAGAACGTGGCAGTGCCGTCAAATGAA
CACGCAAATTGCGTCTTTCACGCAACTCCGACACGACACTGTACTGTACGCGAAACAAAGCTACACGTGCAGAACACTTTGCGAATATCCCGATGGTATG
GTCGACCCGTACCCAGTGTTTTGGCACAGGATGGGAGAAATGGCGCAACGAATGAAGGAAATTGCTGAACAAGCACGGGATTCGTTTACCGGACCTTCGT
CCGACCGATTCAAGATCGAAAATGGTTGTTGGCTCTTCGAGACGTTCgcttcgacgatgaagactcTCGAAGAAATTGCCCTCTGCCAGTCAAAGGATAA
AAGGCTAAGCGCCGAGCAAGTGAAGTTCATGAAGTcggtgatggaggagacaTATGGAAGTGGATCGACGCAATACAACGGTTGGTACCCTCGATTGTTT
TTCGAGTCTCCCGAGGACTCCGGTAAACGCGACGTATTGGTCGTGGATATTCACACAGACACCCCATCGGTTGAGCACGGCGACCCGGGCTGTGTACTGC
ATCTAGGCGTGGGTGACCCTGTCGTTGGCTTTTTTGTCGTCAACGAAGTCATGTATGCTGGACCCGTGTTTAGCAGCTTTGAGTTCGTGACACCGATCGA
CGAGCGCTTGAGCGATGAGGAATTCCAAGTCAAACTTCCGTCGATGAGTGCTACACAGTGGGCACAGAACTCGTACCTGTGCAGTGAANTACTCTGAAGG
TCAAGTTACTGGCTCGAAAGCTTCACATGACTTCCCTCGATGGGAACACCGTTCATGGCTGTGTTAGGTGGATCGAGGGAACAATGTGTAGTGACGATGG
GATGCATGTAATTCCCGGGTTTTATCTTACTCTTCATGCACGTTCAAATACACGAGACCTTGACGTCCGCAAACAGAGATTGCGTGAGAATGCGCGACTC
GTTAGTCGCCCTTTGAGGTCGCTGTCATCTCAAAAAGATTTCGTACCGGCCTCGATGCTTGGAAACTTTAGACTTGCCGCCAACTCTGTCCTTGCTGTAG
TGCGCGGCAGGAAGCTACCGGTGCTCACTGCTCGCTTCCTTTCATCACTGAGTCTAGAGCCGCCAGCTACGCTCGTCACGATCCCAGCGTCGAGTTATGC
CGAAAAGGCTCGATGGGCGCTGCGCATCGGTAACATCCCGTTCGTTGAAGAGAAGTGGGCTCCTGTGTTCGCTTACCTGTCGACAATGCCCAAGGGCGGG
CGGTCTGTGCCTTTGCTAACAGTGCCGTCCTCTCCCAAGGTGACACTAACTGACAGCACTGATATCGTAGCCTTCTGTGCGATGAAATCCCCCGAGCTGT
ATCCGAacgagaaggcgaaggacCTCGAAGCGCTTTTCGATGCTGAGCTCGGACCTCACGCTCGTCGTTGTGGTAGGAAATGCTTGATTCAGTTGAATTC
TCTGGAGTTGGTCTTTACTAACTAGTTCATGTGATTGCAGCCTACCATGTCTGGTTTCAGGATTTCGCGACTTCCAAGAGGATCATGGCAGAGCCCATCG
ACGGTTTGGTTCAGCGTTCAGTGACGCGGGTGCTTTTCCCTGCGCTGAGAATGCTCTTACTGCGTGAGTTGAACATCAACGAGAAGTCTGCCGAGAGATC
GTGGCTTCGAATTGAAGGCGTCCTGGATGaggtcgagaaggagcttgaCGATGGTCCCATCGGCAGTCGCTTCCTCGCTGGTGACACTTTTTCAGCTGCT
GACATTTCGTTCTGCTCCCATGTCGCGTTGCTCATCTTGCCTCCCGAACACGAGTTCATCGCACCGTACATTTCGATGCAATCGATCCAAGATCCGAACT
TCCGCGAGCGCTTTGAGGAACTAAGAGGCTCCAGAATCGGCCAGTATGTGCTCTGGTGCTACAAGAACAAGCGTCCTGCTgtaatgtagccatcttcgat
gttgaagtggatgattTGCATCTTCTATTGGTCAATATTCAGCCGATCGAATATTATCCAATAGAATGCTGATACCAAGTGATTGGAGGAGAGGGTTTCA
CGATGGACAAGTGCGTGGCATGCTTCAGTTTGCAATGTGATCGAGTTACGATCACCCGTTGTAGCTTGGAAATGGTTCTCCTCCAATTCCCCTTTGTGTA
ATTGAATATCGCGCTGTGGGAATTATGAGGGCACGCATGCAAGGGTCTTCTCTGTTTGGGGCGCTGAAAAGTGTTTCGCTGCATTGAAGAGCCAAGGCAT
GTTGTGTTCCCCCCACGGGCGCTATAGCAAACCCAATGGCCCTATGTGTGTagaggacgacgactacTCCATTCGTCAAACTCCTCAAGAACTGGGTCGT
ACATACTCATACTACAAGCACAAAAACTATAGTCGATGGTTTCTACGTGGATTTTTATCAGGCTTGTTGGCTGCCCTGCCGTCTTTCGTTATGCGTGCGC
AGCATCCCTTGATGCAGCTACTAGAAAGTGTGTGCGTGCGTTTGACTGACGGGACCGCATGCCACTTGCCCTTCGGAGTCTTTGAACTgcctcagcagct
tggtgttgTACGACATGCAGTCTTCGTGTTGGCACTACACAACAAAACATGTCAGCTTACACATGCCTAGCTATCAAGCAGTAGTTTTATCCGCACCTTG
TGATACACGAAGTGGAACTTTGTAGTGGACTTGCgctcgcagtcgctgcagtaGATCAGCGACTTGTAGTCCTGGTATTCGGCAGGCATCCGCTCCCGCT
CCAAGAGCTCATCGATACTGGCGAAGTAGAGCTCCATGTCGCCCAGAGACTTGGAACAAAGCGGGCAGATGTAGTTTGTCTTCAGAATGAGAGACAATTA
ATCGTTAGCCAGCATAGTTGCACATGGAACTTCCGTGCTCACGTACCAGGGTGTACTCTTCATAGCAGGAGACATGCATGCAGTGTCCGCAGGGTAGGAA
CATGACTGGTGTCGTCGAAGTGAACATGTATGCGTGACAGATTGGGCAATCAGACTCGAGCGATCGCTCCACGCACTTGTGTTTCTTCAAACTGATGCTC
ATACAGGCATTGCAGCGATCACAGTGGAAGTAGTCAATATCCAGACCCTTGCCAATGCGGCAGATTTTGCACTTGTCACAGTGATAGATGTCCTTGTTGT
TATCGTCGTCGATAAACCTGCACACCTCGCAGTAGTAGCGTCCAAACTCGGATTTACAATTCTCATTGACGCAGGTTTTGCTGATGGGCTACAAGCAAAC
CACCGGAGGTTAGTTGTGCTGTAATGAATTTAGAGGAATCAAGACATTTCGCTCGGGTACCTGAACAGTGTCACATTTTAGGCACGAGACTGTGTCGACG
GAGTAGCGATCGAAGGCGTGATCTTCACTGTCATCTGCAGAGTACACTAGTCAGTTGAATATCGCACGAACTTTATACCAAGTGCAAAAGTGTTGAAAGT
AAAACACACCATGGCAAAAGCGGCACGAATACCACTTCCCGCAACATTTGCCTAGCAGCTTGCATTTTCTCCTGAAGACGAAACAAATGCCCATTAGTTC
GTGTATGCGTTGCTTCCAacgaagcagcaagatgcGACGTACTGGTAATGACTGCACCCCAATATCGTTTTAGCTTCATCCTGTAAGAAGCACCCGACAA
AAGTCAGTCCAAGCGTAATTTGTTTCTACACAAAAACTTGTCAACATACATGATAAGATCTTCGTTTTCGCTCTGCTTCGATGTCACATTCCGCTTTGGT
GGCACCCGCCTTCGACTTGGCATCGTTCCAGTTCTTCATCATGAGGTTCTGTACCGACTCGGCTTTCTGCTTCGGCGTAAGTACCGGACTCGATTGAATT
TCGCGGATCTTGGCTTTCAGCAGTGCTTGGGTGGCCTGAAAATGAAAATGTTGGTAGTGAGATCAAAGGCGTCGAATGTATTTTTCTATTGTGAATGCAC
ATACCTCTGCACCAGAAAGCGGCGCCGGCAACGATGTCGGGCGAACCTCCTGGCTCTGGTTGGTTGCTTGGTATGCTTCATCGTGGGAGTGGTGTTCAGG
ACTGGAATTCCGCGGCGGTCTGTCAGTTCCCCGGATAACTAGGCCGTGCTGAAAACCTTGCGCTTACCTTCTTAACATGCTGCCAGCTACTTGTACTCGT
GTCTAATGGCAGTATTGGGCTGCGTTCCCTCAGCAAGCTACACTCTCTGCAGTCGAGTCCTCTCAATCGAGAATGAAGAGTACCGCCGTGATCGTTTGAA
GTTTCCCTCAAAATAACTAACCAACGACCAACATGGCATTTCAGTCTTCTGGTACAAATAGCGATGGCGTGAAGATATCCGATAATTGCAGGTCAACGCC
CCGTTGGTTGTGCGGTCATAGAGCATGAGAGATCAACAAAGAGGATCGAGGTGCTAACAACCGACTTGCGCCGTTCACCTTTGGTGATTCGTGCATGTCG
TAGCTGCCGGATTTGAGTTCTTTGGGGGTGGTTTCCATCATATCTGCAATGGCACAGCACTTGTCAGGGGGATCAGAGCAGGTCACGCCACCATTTCAGG
AATGAGAGGAACGAAGAGCCATAGCCACCCccaaagttgaagttgctctCACTTGACACCAGATGACAGTGCAATACGCCCATTCGACAGGCAGCAGTTA
TTATCGCCCACTCGACACTTTACTTGCCTGGTCTCAATAATGCCGCCAAAGTCCGCCGTCACTGCTGAGCGCCTCAAAAAGGAGCTGGCAGCCCAGAAGG
CCCGTGCAGAGGCTCTCAAGCACCTACACAACACCGGCAGTGGTCCCAGCCAGCGTGAATtagcgcagcagcagcaactccgtcAAAAACAGACAGCCAA
TGCCACATCCGCAATAGCTCAACGTCGAGTTGTGGGTGTGCAGCCTCAACCGTCTGCGGCTGACAAGTTCGACCCTCGAGTGAGGGACAACACGCTGCAT
GCAGTCGCTTTGCGGCGTgcacaggagctgcagaaaacggagcagatcgagcagcgtACAGAGAGCTTCCGTTTGGATGTCAGGACGACAGAATATAACG
CCTTGCCCTCTGGATGGCAAGAAGTGGTAGACCCGGCTTCTGGAGACTCGTACTATTGGAACGAGGTGAGTGATGAGGATATCGAACTGTAAAATACTGT
ATTGTTGGTGACTGAGTAGAGGCTGGTCGtgatttttgttgttgttgttgcagacgACTAACGAAACCGTGTGGGAACGACCCGGAAGTTCGGCACCAAA
GGTGAGATTTTTTAAAGGTGTCGTCTGCTTTGGATGCTTAAAAGACCTTACGTTTTTGTGATTGTGTTTGATGCAGACAGCTGAGGTGGAAGCTGTTGAT
GCCAAATCTGTTGACGGGCAATTAGCTGAGTATGCGAAGTCCAtgctttgttgttgttggaaaGTGACAGAGGTGTGACTTtggttgtcgctgtcgtgAA
GTGGGTGGGAAGAAGTGCCTGATGCTGCGAGTGGTGACGTTTACTATTGGAATCGCAAGACGAAcgagacgacgtggacaCGACCGATTGCTCGGAGTGT
GTCGTTGGGTGAGAAAATGTGGTGTGCAGATTGAGCAGTAAATGCGGTCTAACTTTTGTGATTattgcagcacaagctctTGAAGCTAAAGCAAAACTCG
ACAGCATCCTGAAAGGCTGTGGAAGCTCAATAGGCAAGGCCAACTCAAGCGCAAACGTGAGGCCAGAAGCAAAACCGAATGCAAGTCGTACCGattcgtc
ttcagcaaccgGCGCAGGTGCACCATCAAGCACCACATCCTCTAAACGCCCCCAGCAGAACTCAAATCCAGTCAGCTTCCAAAACAAGCGGCGCAAGCGG
TCCGAACCTGACGATGGTGCTGTCGACTCGATGGATCCAACTGGTACGGGTGGAAAGTGGTCTGATGGGCTCGAGCAAACATGAACAAAACACAGAATTG
CATCTGTAAATGGTGAATAGATGGTTAGTACCAGAAGCAATTGCAGTCATATTCTTACAGCCTTCCTTAGTACTAGCTTTTCTAATTGCAGCAGTTCTGG
GAGCTGTTTTTCTTCTCAAACTGCATCAAGTTGAATGCAGCGTGGGGTTTGGAACTACCAATGAGTAATTTCGCGTAGGGAActactacatgtacaagcT
CTCAACAACGGCACTTGGGCTTCAAATTCTTCAGAATTCAAACGTTTGTCGATCGAAGTCACGAACTTGTAGCTTCTGAACTCTGGACCAGCATATATGA
CTTCGTTGACAACAAAGAAGGCCACTGTGGGGTCCCAACTCCCAGATGCAATATACACTCTGGAGCATAACGAGCTAGAATGGCAAGGAGGTAACACATT
GAGACAGGGTACTTACAGCACTCGATAGTTTTTGTTTAGAGAAGGCGTGACTGGTGCTCCCAGTGAGGCTGGTCTTTCGTTGATACTTTTGTGTCACCAG
GGGATTGCAAGCG