Description :
From Genome Similarity Track
Location :
Scaffold_6:2403974- 2405806
Transcript NameFunction/comments
Physo_516049transmembrane protein, putative
Physo_304747Mitochondrial Protein Translocase (MPT) Family puta

Sequence
1832 bases(100 bases per row)
TTTCGAACAGGCCGTACTTGAGCAGAACGATTTTGCACGGCCCCCTGCAGTCGGTGCACCCGCCAACCATGGACAGATCGCGCTCGGTGAACGCGAGGAA
GTTGTTGTCGAATGTGATGAGGAACGTTGCGTCTGCCGATAGATATTTCGTCAAGATAAACAGCAACAGCAGCGCCACCGGTCCTACGATGGTGCGCCCC
ACGCTTGCCAAGCTCGCACCAAAGACGGAAGGGCGGAGGAAACTTCGCCATCCGCGAGCTTTACGCTGGAGTCGCTGCTGTTCGTGGTAGTTGGTCGCCC
AGTTTGTCGAAGCGTCTCGCTCCTCGAGAACAGCGTCACGAACTTTTGTGGACGAACGGCACGCCCTTGAGCGAGTTGCACGAGCCGCGTCGTGTGAGAA
CTCGGAGCAGGAAGAGCCAGTACGCATCACCAACTTTGTTGCTTGCTGAGCAAATTTTAGACGTCTGCAGTTCTAATAATTGCTACTAACAATACACTTG
CGCGATGATCATGCATATCCCAAAGTAATACTCTCTCCACATCGAACGTGTATGAACGCCGTATTATTTATTAAGATACTCACCTATCCGCATTATGAGA
GTTTGCTCAACAGCTCGTCGACAGCTTTGAGCTCATCTCTTAGCGACATCAAGCGGTCCGTTGTGTCTTCTGCCCTACTCTGCACCCCACCGAAATTTAG
CACGAGCTGTGCGCTTGCAGACTGGATGTCCAGGCAAAGTTGCCTGCGTCGCTCTTGCAACTCCTCAACACTCAAACCTTCCAGTTCCGGAAATTCTACC
GTTTGGTCTTGTGCATCGGGCGTAGAATCGGTAGGCGCTGCTTCCAACACCGGCATCGCAACTTTTTCGGGGCGATCAATGTCCTGTACCGGAAACAGCT
CTCTTGCAAGGGGTTGCTGCACCGGCGATTGCGTGACAGTATTATGCTTGGGCGCGTTCAGCTCGCGACGGAATCGTTCGAAAGCTCGCACGAAAGAGGC
ATCATTCAACTCGGCGCTGGTAACGCTAGATCCACCGAGGAAACTCAGGACGCTCTCCTCCTCCTCTTTCTCTTCCTCCTCGTCTTCGTCGATTGACAGG
CCATCGAAATTAAACTTGCGAGCGAGCACCGGGGTGGAGTACGCGTCATCACCGAAGCGAACCTGCTTTGACGATGAAGCAGTGGACTTCTGGTTACTTC
CAGTGGTCGGGGTGGTCACGCTACTGCCAGTCGTGGGCGTTCTGTGGTTCTCATCTGGCCGCTCGTCCGTAGATCTGCTCGGGCTTGATTACAGTTTGAG
GATTTCATGGGAAGCGCTTCGGATGGTTAGCTTTTTATGGTCTTCTTCTGAGTCAGAATTTCTGTCATGACAAGGCGCTTGGTCTGAAGATTGTGGGAGT
GATGACCCACTTTTCTGCTGGATCTGAGCCTTAAGGCGCCTGATGTTTGCCGGAATCTGGATAAACACACGATCTACCGCGCGCATTGGCCTCATCTCAC
CGGCCACCCACTTGCACAACCTCGTGAGGTTTGGAAACTCCGAGCATGCAGCAGCCAAGCTCGCGGTCAGCTCTGCTCACGCTGTCATGTTACATCGTTG
TTGCGTCGCCTATCCTTTTGTTTATGGACGATTTGCTGTGTATTGGGGGTGTCATGTCAGAATACGGACATGAAAAAAATCTTCCGCTTCGGATGGTATG
CATGTCTACATGTACGAAGTATGCTTCAACACGTGTCCGTTGGCACCACACGGTGGTATTAATACCGTAAGTTTCGCAAGCTTTGAATACGGTGCATCAG
AACGGGATTTGAGCCACTTGTTTCGGACGGTT