Description :
From Genome Similarity Track
Location :
contig_33:240377- 242152
Transcript NameFunction/comments
g8013.t1hypothetical protein

Sequence
1775 bases(100 bases per row)
ATACGTACACTGGTCGAATCTGTATCGCAGTAAACCCGTACCAATGGCTGGACCTGTACTCCAAGCCCACCATGGAGAAATTCAGCGATGGCAAGCGCGA
GAACAAGCCCCCGCACGTTTACGCCGTGTCCATGGAGGCGTTTTTCAATATGCGGCAAAAGCAGGAAAATCAGAGCATTTTAGTCTCGGGGGAGTCGGGA
GCCGGCAAGACCGAGACTACAAAGATCGTCATGAGCCACTTGGCGGCGCTGGCCACCAATTCCAACTCCAAGGTCATCCAGCAGATCATCCAGGCCAACC
CGCTGCTCGAGTCGTTCGGTAACGCTAAGACTGTGCGCAACGACAATTCCAGTCGCTTTGGCAAATTCACCGAGCTGCAGTTCACGATCGAGGGCCAATT
GATCGGCGCCAGGTCCCGCACGTACCTGCTGGAGAAGAGCCGCGTGACGACGCAGGCCCAGGGAGAACGCAACTTCCACATCTTCTACCAGCTGCTGGCG
CAGCGCAAGAACTTCCCGGAGCTCGAGCTCGACATGGTGGACTCGTTCAAGTACGTGTCGTTCCAGGCACAAGCCCCCGGCGGAGACGAAGAAGGCGACC
TGAGCCGCACACGAGAGGCTCTGGAGCTTGTGGGCATTGAACAGCCATTGCAGCAGGAGATTATTCAGATTCTGGGCGCCGTGCTGCATTTGGGAGAAAC
GGCGTTCACGACCCGCAACGGAGACGTGGATGCGTCGCAATTGGTGGATCTCAAGCACTTTAGCGTGGCCTGTCGCCTTCTGGGTGTGGAGGTCGAGGCG
CTGGAGCGCGCGGTGTGCAACCGAAACGTGTTTGTGGGTCGCGAAGTGATTCTGAAGCCCATGACGCACGACCAGGCGGCGGATTGCCGTGACGCTCTGG
CGAAAAGCCTGTACTCGAAGCTGTTCCTGTGGCTTGTGGAGCAAATTAACCAAACTATTGGTGTCAAGGTGAAGGGCGCTGGATCATTTATTGGCATCCT
GGATATCTTTGGTTTCGAGCACTTTGAGACGAACTCGTTTGAACAGTTTTGCATCAATTATGCCAACGAGAAACTGCAGCAGAAGTTCGTGCAGGACGTG
CTGAAGACGGTGCAAATCGAGTACGAAGAGGAAAACATCTCGTGGTCCCACATTACTTTCGCAGACAACCAGGACGTGCTGAATCTCATCGAAGGCCGCT
TGGGCGTCATCAGTTTCCTGAACGAGGAATCGCTGCTCGCCACAGGCACGGACGCGTCGTTCGCGAGCAAGCTCGGAGCTGTGATGGAGAACAACCCGCT
GCTAGAGACTCCGCGACTGAACAAGTGCGCGTTCTCGATCTACCACTACGCTGGTAAGGTGACGTACGACGCGTCGGGCTTCCTCGACAAGCACCGCGAC
GCCATTTTGCCGGACATCAAGCAGTGCATGAGCAAGTCTTCGCTCAAGATCTTGTCGAAAATGTTCACGGACGATGTGAACGCCAGCAGCGCCAGCAGTG
CGGCACCCTCGGCTCGTGGCAGGTCGCGTAGTAGTAGTAAGAAGGGAGGCCACGCCCAGACGCGCCGCACCACGGTGGGCACCCAGTTCAAAGAGAGTCT
GTCGCAGCTCATGGAGAAGATTGGACTGACGGAGGTGCACTACGTGCGTTGTTTGAAGCCCAACCCGCTCAAAAGTGCCAACTGTTTCTCGCACGGCGAC
ATCGTGAGCCAGCTCCGCTGCGCCGGTGTTATTGAGGCTATCCGTGTGTCTCGTAGCGCGTACCCCAGCCGTATG