Description :
From Genome Similarity Track
Location :
Scaffold_1457:2403- 4562
Sequence
2159 bases(100 bases per row)
CGCTTGTATCGATCAACTTGCTTTGGCTACCACGTATCCGGTAAACAGATCCACCCAAATCAACAATTCTGTGTTTCTTTTGAACGACTTGGCAACGAGG
GGATATGATCCATGGCTATGATTTGGAAAGGGTAAGTCGCTTGGACATTCCCAGGTGATTACCCTTCGATTGTGGGCCTGCCCTTGCCTGTCTCACAATC
CACACATTCATCGACATATTGTTGCACGCTCTTGAATAGTCCCCTCCAGTGGAAACATTCCCGGATCGGTTGGTAGGTCCGACCAATACCCTGATGTCCA
CCTTATAAACTAGCGTGATAGTGATGTAGGACATCCTGTTGTAAGGTTTCCGGCATCACCAGTCTCATCAATCCATCCCGATCCTCGTTGACTCTCTTCG
TAGGGGGGGGGCAATAGAAGAGCAAGTCATTCAGATCCACTGCGTAATCCGTAGCGATAATACTGTAGGATTTAGTATCCTCCCGACTCAGGTCTCGTAC
ATCCCCCATCAGATACTTCTTTAGTCCCAAGATCCACGCTTCCTCGTTTTGTGCTTTGAGGATCCGTTCAATACGGACTCCCTTCACAAATGTTGCCTCG
AGGATCTGGGGGCTGGATCCAATCCTTCCTCTGGACCTAGTGACGGCCATCACCTGGACTGTTCTTTTCCTGGATCCAACTACCACCACTTCGTCTAGTC
GGTTCAATGTAACGAGATCCTGATGCCCGGCTTCTCTCTCCACTTCGACACCACATTGATTCCGTAAAGCGGCACTGGCCAAGCTGTCTGCACTGGCATT
CCAATCTCGCTTGACATGCACCAACTCGTTATTCAACCATCCACGCAGGTGGATCATCACTTTCTGCCGTAACAGTGTTAGGACCGGGGCCTTGCAGTCA
ATCTCGCCTCGCACCTGTCTGATTACCAAATTTGAATCCCCACAAATCACCAGCCTTTTTTGGATCTTTGTCCCTTTTAGTAAATCCAAACCCAGAAGGA
GTCCGTTATACTCCGCCTCATTGACGGTGAGGCCTTCCGCGTAAGTGGATCTGGCCCGTACAACTTCCCATCCGGGCAATCTCCACAGTATTGCACTGTA
TGCTCCTCCTCCGCGTCGTACACGAGCGGATCCATCGAAACTCAGGACGTATAGATCCTCATCCACCTGTACCGTCGGGATCGGGATCGGGATCCGGCGT
TTGGGCTCTTTCTTAGGAGCGATCCTAGTCAGTGCTTCAACCATCTTAGCTCGAGGTGTGATGCTCGCGGCCAAAACTCCCAGGATCTCGTCTTCCCCTT
TCGAGCATTTCACAATCTCCAGTGTCCAAGGCGAGAGTAAAGCTGCCCACTGTCCCAATCGTCCTTGTAAACCGGCCGACTTGAACAACCAAGCTAGCGT
AGAGTATCGAGTCAGGATCCGGATGGATCTTCCCACCAGCAGGTTGTGATTGAGATCCAACACGCGCAGGAGCGCGAGTATCTCCTTCTCCACCACTCCG
TAGGTCAATTCATTTGGCTTTAGCGTCCGGCTGACGAAGGTGACTGGATGACAGATCCCTTCATGTTCTTGTACCAAGGCTGCTGAGACCGCCCAGTCAC
TGGCATAAACTATCACCGTAGGTTGACGCTCTGGATCGAAATGACGGAGGATAGGCGTGGTCGCGATCCTGTTCCTCAGCTCCACGAATCCGTGTTGAGC
TCGGATCCACCGAGATTCTGCCTGTTCCATGTTCTGATCCGTCGTCTCTATCCAGACTGGATCCTCTCTCCTTTGGTCCCGGGGTGGATCCAGCTCCTGT
TTTAGGTCTACTTCTGGCGTCGTACTACTTGGATCCCTTCGTGGATCTGACATCTTGAGGGCCAGAGCTTGTTGGATTTTGATCCGGACAGCTGTAGTGG
TCATCGCAGCAAAATCTACCTCTCTCAATTCATATAGTACCGCAGCAAACAGTGCTTAATCCTCAATGAACCGACTGTAGTAGTTCAAACTGCCCAAGAA
GGATTGCATCGCCCGTAACGACTGTGGGAAGGACAAGTCTTTTAACGAAGACAGGTCCTTAGGATTCGCCTGCAACCCCTCCTTGGAGACTCGATGACCT
AAGTAATCCACTTTGCGCATCCCCCAATAGCTCTTCACCACGCTGATAGAGAGATTCCA