Description :
From Genome Similarity Track
Location :
Scaffold_2:240276- 250120
Transcript NameFunction/comments
Physo_127471isomerase-like protein
Physo_127472hypothetical protein
Physo_110459PREDICTED: similar to Ras-related GTP-binding protein ragA
Physo_110464Malonyl-CoA decarboxylase

Sequence
9844 bases(100 bases per row)
ATGAAGGCCAAGTTCGTGAAGTTCGGGTGCGTCTTCGCCGCCGACAGCAGAGAGCAATAAAATACCCCCCCCCTCACCCTATAAACCTTTCCCCCCGGTC
GAATAGCAAGAAGATCGTGGCCATCGGCAAGAATTACGAGGCCCACGCGCGCGAAATGGGCGCGGCCTCAGCTCCGAAAGACCCCGTCCTCTTCCTGAAG
CCCACCACCAGGTTAGCATTGAGTACTACTTTGACTGGATATCATCTTGAAAGTACTAGCAACAGTTCCTAATCTTCTTGACGCCGACGATCGCCAGCTA
CGTGCGCAACGGCGGCAGCGTCCTGCTGCCCCCTGGGATCGGCGAGGTGCACCACGAAGTCGAGCTCGGCGTACGTTGCAGCATGCCATCTGCTAGTTCT
GAAGGCTAACGTGATTTTTTGGCAGGTGGTGATTGGCAAGGGAGGCACGGATATCGCCGAGAGTGACAGCATGAGCCACGTCGCAGGATATGTATGTGAG
TGTTGACTCTTTAATGTTGTGGCGATCCGCGACGGGAATTTTGACGATAGATACGCTTCGTGGATGGTAGGCTCTGGCGATTGACATGACCGCACGCGAC
CTGCAGGCCAAGGCCAAGAAGGCGGGGCTGCCGTGGACGCACGCCAAGGGCCTCGACACCTTCACGCCCATCAGCGACTTCATCCCCAAGTCGGCCGTGC
CCTCGCCTCACGACTTGAACCTCTGGCTGAAGGTGGACGATGAGCTGCGTCAGAACGGCAACACCGGCGACATGGTCCACAAAATCCCGTTTCTGATCTC
CTACGTGAGCCGCATCATGACGCTGGAGGAAGGCGATTTGCTTATCACCGGCACGCCGGAAGGAGTGGGGCCTGTCCCGACGAACAGCGTACGTGTGTGT
CTGCGTGGCTGCGCATGATGAGTTTGTGACTCATGCGCATCCATCGAATGTGCTGGCTGTAGGTGATCACCGCGGGTATTACCGGACTGATCGACGTGCG
CTTCCCGGTCGAAACCCGCGTGTACAAGGCGTAGCAAAAGAAGCAACTTCTGCTAAATAACTGCGTCTAGCAATGCTCCAATCGACAATTGGCAGCCACT
TCGAACTGTGTGTGTTCAATGCTCGGCTGTTTCTAACGTTGTTTGGTTGCTGTTGCCGCATCGACCAGCATGGAGATTTTGCGGAAGTTATGTCTACGTT
TTGAACCAGCAAACGTCGAGCGAACATGCCAGCCTCGGTAGATTGCTTGAATGCGCAACGCTGCGGCGTCATGGCGCAGGTTGCGAACCGCAGACTGGGC
GTAGGAGCGCACTTCATGTCGATTCGATGGCACCAGTCGCATTAGTGAGCCCAGGATGCCGCTTTCGACCAGTCTTGACCGAGCCACGTGAAGTTCCGAT
ACAGCAGCCAATGCGCGTGTAGCCTCAAGGAGTAGCGCTTCGCTCAGGCCCTTGTCGCTGCCGTGCCCAACAGCACGACCTCGATCCCGTACGGGACTTA
CGTATCGTACAAGTACAGGCAGGAGCCCAGCATCCATCAGCTTCAGTACATTTTCAGGACGCTCGGCGAAGTTGGCGATGATCTGGGCTACATGAAGGCG
CGTGGAGGCAAGTGGGTGAAAGGCGAACTGCCCAAGTGCCGACAACAGTGCAGGCTTGCATAGCGTTAACCGGGAGGGCGCATCGAAGGAGAGCTGCGCA
AGTGCATCCAGCGCATCGACTTTCATGCCGAAATCATCGCCAGCCAAGATTCCAAACAAACACTTGACAACACCGCGAGCAAGAAGCTCGATGTAGTGCT
GGTAGTCGCGCTCTGAAGCTTGGTGTGATCCACGAGGAGAATCCTGTGCACTTGGAGGCGCGGTTCCTGCTAGTTGCTTGGGCTCTTTGCGTCGCTTTCG
CTCTGTGCAGATTAACAGCGTAAGCAGAGTGATAACTGCACGGCGAACCCGCTTATCAGGTGAAGCGTATAGCTCGCACGCCGCGATGTGATCGAGCACC
TTCGATCGGATCACCTGCTCTCGATTGGCGGTGTTCCGAGCCATGGCACAAAAGATTCCAAGCGTTGCACGGGTAATTGTAGTAGCCTCATAAGCTGGCC
AAAAGGAAACTGAGCGCGAGCGAGGACGAGATGACGAAGCTGATCCTGGCCGCGAAGTGGATGCCTTGGTCTGGACAGGTACTGTCACGGCTGTGTGTGG
GCGCTTACTATCATGGTCCGATGTTGGCAGTCCGCTGTTGGAAGAGAAGCATAGCTGGACAAGCCGTGGCATCGCTTCAGCTTGCACAAGAGCTGCATGA
TTGACTTCATCCTTCGCGACATCATCAAGAATCGCTACCACCAACAGACTCACTTGAAGCGATGGTCTCGTGGCACACGAGGACCCGCGGCCAAGGACGC
TGAGAACGCAGGGCAACAGCCCAAGTGATGCGAATCGACGAGCATTCTCCGCCTCAGAAAGCAGCAAATGTATGAAGCTCAGCAACTCGCGACGGAAGAT
TGCATCTTTGTCGAGGAACGGATCTCGCAGCAGCCCAGAGAGTGTGGTGAAGTGCCCCGAGTAATAAAACAGCACTCTGTTGTCGCGAGTTGCTGCAAGC
TGATGAATCACCGAGGCGGCCAGCGTTCGTGTGCGTGTATCACCAGCCACACCACCCCTTGTGCCTTGTGGGGCATCGCTACCAGAGCAGCAGTTCAACA
TGAAGGCAAAACCTTCGCGTTTGGCCACCACCTCACGCCACTCGTCGGTTGTTACTAGTCGTGCGACGACTTCGAAGCCGGCAAGACGCAGCTTGTGGTC
TGTAGTAGTATGAAGCAAGGAGAAAACGCAGTCGATGCCTCCTGGTGCTTGGAGAAGCTTGGTCTTGACAGAGGAGAGACGGACAAGCGCGGCGAGCGCC
TGTGCGCAGTCATTAGAGATCCCCGAGTCCTCGCGATCCACGGGTGAGCTCATCATGGTCAGAATTGCACCGAGCGTGCCGACTTCGTCGAGAAGCTCTA
GATTTGCGGCTGCGGTGCAAGCAACGGAGTGAACGAAGGTGAGACGATTGAGCCAATCCGGCGAGGCGACAAGAACAAAACGTACTGTTGCGGCTCAGAG
AGGCGATTGCAGCGGCCGCGTCGCGCCGGACTTCCACGAACGGCGACCAGTAGATGATCTCGATCAGTGGACTGACGTCGTCGGCCTCAACGTCTTGCCG
CCGCAGACTTTTGAGGACTTGGGCGCTGTGAAGCGAGTCCCGACGTCGCTCGGTGTGCATGGCGTTCAGCTCCGCTTCGCGAGCCAAGAGCTGCTGCCTC
TTTCGGAGTGAGACCGCAGCGGTGGGCGGGGCCCCTCCCACCTTTTCGGCTGCTTCAACGGCATCGGCTTTAGCGGCATGCTGCGGTCCATCACTGGCGC
GACGAAGCCGCGCTGGCTGCGAGAGCCTGCGGCCTGTTGGAGGTCTGGCCATGACGTTCTGCTGCTCCTTCGTTGCTGCCTTGGCTCTATCAGGGCTCGG
ACTCTCGTCGGGCTTCTTGCTGTTTGTGCTTGCCGCACTGGCGAGGGCGGCTGATGCTGACGCTGACGCTGAGGCGGATGCTGTGGCGATGGCGGCTCGG
AACTGCTCTCGAGGATCCTGCCGAGCTGTTAACACACCCGGCAGATGCCTGTCAGCGGCTGTGGCTGGCCGCTCCGTCCTCTTCGACGCTGTGCGCGGCG
TCGCTGCGGCTGGGAAGAGGTCCGGCGGCGGCGCATTCCATCGCCGCTTGGCGACTGCGCTCCCGGGACGAGAAGAGGGCGCTGCCCGCGGCTTGGAGGT
CAGAGCGGGTGGTGGCTTGAGGCTGGTGGCCAGCGGCATCGCGCAATGGCGCGGCAGCGGCTGCAATCGACTATACTTAGCCACCATAGTTGGTTGAAGG
TTTCGGTGGTCGTAACTTTGATTTGGTTCCAAATATTTTATGTCTGATTCATACCTTCTAGATTTAGAACCGTTCTGATTTTCGCAAAGCTCGACAAGAG
GAAGGAGCCCCAGGACCAAAGTCGCCGCCGCCGTCGCCATGAAGAAGAAAGTGCGTGGGCTCGCGGCTGCCGCTCCCTCGCTGGGTCCTCTCGGCGTCGT
CGACTAACCGCTGAGTCATGTACTGCGTGGCCGTGCAGGTTCTGCTGATGGGCAAGTCCGGCTCGGGCAAGACGTCCATGCGCTCCATCATCTTCGCCAA
CTACCTGGGTATTATGACTGCTCCTTCTCAGTGGGTGGCAAGTAGAGCAGTCTATTGATGCTGCTTTTGTATGGATTAAATTGACCAGCACGCGACACGA
TGCGACTGGGACCCACGCGTACGTGAACTTGGTTGGGGGGCCGGGAGAGGAGTGTACAATGACTTGTTAACAGACTTGTGGCGACTGCTGTTGGTTGTTG
CGGGGCTGCAGTGGACGTGGAGCACTCGCACGTGCGTTTCCTGGGCAACTTGGTGTTGAATCTGTGGGATTGCGGCGGGTACGACGACTATAGGAGTCGC
TACAGCTGAAGGAAATCTTGTAGCTGAGTCTGATGCGTCTCTGTTGTGGCATTCGGCGTTGCAGTCAGGACGCCTTCTACGAGAACTACTTCGAGAGCCA
GCGTGATCACATTTTCCGCAGTGTGGAGCTACTGATCTACGTGTTTGACATCGAGAGCCGCGAGATCGACGTACGGGTGCGCCGGGGAGTGCTGTAGTGG
CTTGTGCTGATCTATGGCGTCGTTCGCTCCAAATGCTATCGTTTTTTTCTTCTTACAGAAAGACATGGCCCACTTCGACGGCTGCCTGGAGGCCATCGAC
CAGAACTCGAGCAATGCAAAGGTGTTCGTGCTGATTCACAAGATGGATCTTGTCCCCGAGGACCAGCGTGAGCGCGTACGTTGCGATTGCAAACTAGGAG
TTTGAAGTGAATTGTGGGCTTGGGCGCTAAACTTGGGTTGCTTGTGGTGCTTCAGGTGTTCAACCAAAAGAAGGAGATGATTTTGGCGCGCACGGGCCAG
CTCCCTACGGTGTGCTTTGGCACGTCCATCTGGGACGAAACGCTGTACCGCGCGTGGTCCTCCATCGTGTACTCGCTGATCCCGAACATGCAGGACCTGG
AGAAGCACCTGAACAGCTTTTGCTCCATCTGCAGCGCTGACGAAGTGGTGCTGTTTGAGCGCGCGACGTTCCTCGTGATCTCGCACGCTACGCACACGAA
CCACCGAGACATTCACCGCTTTGAAAAAATTAGCAACATTATCAAGCAGTTCAAGCTGAGCTGCAGCAAGACCCAGGCGCAGTTCCAGGGCATGGAGGTG
CGCAATTCCAACTTCACGGCTTTCATCGACTTCTTCACCGCGAACACGTACATCATGGTCATCATGTCTGACGACTCAATCCGTAAGTACCTGCATAACG
CCGGTTTATGGCTGAAGGGCTTCGCTGTTGCTAACAATCGCCACCTATTTCGTGTTATCCGCTGGAGTAGAACCGGCGACGATTCACCTGAACATCAAGG
CGGCTCGCCCCGTGTTTGAGGAGCACGTGCAGCAGACGAGCTAAGTGACAGCCGCAGGCAACATTGGCGTGTTATTAGCAGTGACGCAGCAGAGGTTGCA
GTACCCGCAACTCAGAGAGTTAGAAGTCTCGCAAGACGGCAAGAGCACAAAGTAACGCGTGTGATTGATGCTAAATCTAACGGATGAACAGCTTCTAGTC
GATTCAGAGCATCTTTATTTCATATAAGCTACTGGGGAGGAGGTGGCGGTGGACTGGAAGACGCGTTGGTTGAAGCCAGCATGTATCCTCTGCGACGCAG
CGCCCGCAGCACCACCGGCGTGACAGCAAACGTCAGCGGCCACCGGACAGGGGCCAGCACCTTGTACAGCGTGTAGGCGATGAGAAAGGACCCGGCCGAG
TTGGTCGTCGAGTCACTCACCGACGAGGACAAGCCCACCGAGTCCAGAATGGCCGTCACGTCCACCCCACTCGAGACGCCCACGTAGATGACGGAGAACG
ACAGCAGCGAGAGCACAATGTGCGTGCAGATGCCCACGCGGCCGTACTCGATGGCGAAAGTCTTGGCTCGCTGGCGCCACGACTGCGGCTGCGGCTCCTC
TCCAGGCTGCTCCAGCTCCTTCTCCGCCTCACTCGCGCCCTGCGTTAACGCATAAACATCGTCATTGTATGTAGGACTGCGCAGACAGACAGTCAACAAG
GCCGCACCTTGACAGGCGTCGAAGCGGAGGAAGACGAAGACGCCGTGTCCCCGCCCGTGAGTGGGGACGTCTCCAGCGAGTCCTTGGACGCTCTGCCACT
GGACCAGAGGCGCACCACGCCACAGTCAGAGCCGCACGCAACAGCAAACGACGACGGGAAGCCAGGCAGGCGGCGCGACGCAGCGGCGGCAGCTCCAGCA
GGTCGCGGGGCTTTGTGAGGCCAGGACGGGGACGAACAGGAGGTCGAGGACGAGACGACGCTGGAGCACAGCAACCGCACGCCCAGAGCGCGCGCGCGTC
TGCCGGAGTCGACGCCGCACTGCGCCGCGCCTCGAAACACGCACAAGTACCTCACTCCACCGCGCAGCATCATGGAGAGAGAGAGAGACGAGGCTACGCA
GCTACTGCACTTCCTGGCGATGCGGAAAAATGATCCAGGTGTAAATGTGTAACGTACACCAAACACGACGAATGATGTCGGACGCAGTGTGTGTCCCATA
TTGAAGAGAGGAGGCGGACGATGGCTTCGATGCGCGGCCTCTGGGCGGCGCGAGGCGCGCTGCGTCGCCATGTGAACCGATCTCTGGCAGCCGAGGCGTC
CCCCCGACTGGCGCTGCAAGGCCAGCGTCAGTGTCAGCGCGCGCTGTGCTCCACCAGCAGCGCCGACGGCGGAGACGCCAAGACGGACTCGGCCCACCAG
CGCCAGCAGTCCTCCTTCCTGCGCAGCATCGACCTGAGCAGACCCGCGGCGCAGCGGAAGCTGTCCAAGCTGATCCAGGAGGTGGTCAAGACCAAGGCCA
ACACTGGCGGTGCGTCCACAGTCTAAGAGAGTCAAGCGAGAGGCTGGGCGGAAGCATCTAATTGTGCGGCTATGTGGGGGCAGACTTCGTGCCGCAGGTG
GTGATCCAGAGTCTCTGCACGACGTACAGGGGCATGAACATCGACGAGAAGAAGCAGTTCCTGCTCATCCTGGCGCAGGACCTGCACATCGACCCGGCTG
TGGTGAGCTCGGAGCAGCCACTTTAGTCTGCGTGCTGTGGTCTGGCGTGGCTCACTATTGAATGTTTTTGATGGCAAATAGGCCCTGCAGAGTGCCGCTC
AATTCGACCAGAACCTGACCAATGTGAAGGACGCCCGTAGCGGGGCGGTTAATTGGGAGCACGAGAACGTCGAGAGGTATCTGCGCACCTTCCGCAATCT
GCGGAATGCGCTATCGCCGCTATATGAGGTAAGAGGTGAATGCAAGAGCCAGGGAGTGCTGTTTTTTGTCAGAAAAGCTTACTGAGTGTCTGCGGTGGCA
ATTGCAATGCTGGTAGACCTTCTTCCAGCAAATCTTGTCGCAACGAGAAAATGGAATGCTGTTCTTGGTGCAGTTACGAGCGGACCTGCTTCAATTGTTG
CGCAAGAATGCGAACCATGCCGAGATCCCTGCGCTTCGCTCTCTTGATGCGAGCTTGAAAGTGAGTTAATTCACCTGCACTTGGAGATCGATGTCTTACT
TTACCTACTGACGGCGTTTATTGAGTAGCAATTTCTGGCATCGTGGTTTAGTGTTGGCTTCCTGAAGCTGGAGCGTGTGACGTACGAGCACTCTCCTGGC
CAGCTACTGGAGAAAATAATTCGCTATGAAGCTGTCCATCCAGTTGGCACAATCGCTGAGCTAAAACGACGCCTAGGTACACTGCACATTCCTTAGCTTC
CGCAGCAGTCGCCACCTCAACTAAATATTTCTATTCTGCCAGGCAATGGACGGCGGTGCTTTGCATTTTTCCATCCGAGGTAAGAAGCTTGCAGTCACTG
GTAGTCATATTTACAAAACTAATAAGTCGGCGTTTCTGGGTGAAGTATTCCAGATGAGCCCTTAGTGTTTGTGCATATAGCACTGATGCAAGAGATCGCC
TCCAGTATGCAGTCCATTCGCGATGAGACGGAGCAATTGGCAGAAGCATCTCAGGCGAAAGCTGCAATCTTTTACTCCATCTCGTCAACGCAGAAGGGGC
TCTCGGTAGGCTCTACTGCCTTTGAAGGCAACGTATAGTATATAGCAGGGTACTAACTAACTTGCGCCTGGACTGTAAGGGTGTGGATCTAGGCAACTTT
CTCATCAAAGAGGTTGCCAAAGCGCTGAAGACGGAGTACCCGCACCTGAAGACATTTGCGACTCTGAGCCCTCTGCCTCAATTTATGCCGTGGCTCGAAA
CCCAGCGGTACAAAACTGACGAGTCGTTGGTATCTCCTCTCGAGCTGGATGTCCTGACCGATGTTTTGGAAGAGCGTGGCATCGCTTCTCAACCAGATTC
GACCGCCGTGGGGGTTGTTTTGGACGCTCTCAACATTGACGACTGGAGTGAAGATCCAAGTCTGGTGGCAGCGTTAAAGCCCATAGTGCTGAGGCTTGGT
GCGCGCTACATTTACCACGAAAAGAAGCGCGGAAAGGCGTTGGACCCGGTCACGAACTTCCACGTTCGGAATGGCGCCATATTCGAGCGGATCAACTGGC
TGGCCGATCTGTCCAAGAAGGTGGGTCGCCAACTGATGCGTCATTATATCCCCATACTGATCTGCCCATAATCTTACTTCCGTGCCTTGTCGATATCAGG
GTCTCGCTCAAAGCGCTGGCATGATGATCAACTACAAGTACGATCTGTCGCACGTCGAGGCCAACAATGAAAACTATTTGTTGCACAACATCATTCCCAT
CGGGCTTCAGCCGCAGCAAGTGCTCGGAGCCCGCACCATTTAGTCATGGCGCCCAGATCGATGTCCTCCCACTATTGGAGGCGAAGCTGATGAATATTTG
AATGGAAGTTTGGCTTTGAACAACAACTTATCAGCTCCGAACCGAAGGACGATTCATTTTTAGTTTTTCGCTTTGTGAAGAGTCGTACACGAGCACCTTC
TCGTCTTCCACAGCGAAGCAACGATGGTGCTAGCCCAAGACGAGATCGACGCTTGTCGCGAAGCGTTCCTAGCGTTCGACAAGGACCGGTGGGTGCATTT
TACAAGTGGGCAGACTACAATTGATCTCTAATCCATGAGAATTCGGTGCAGGAGTGGCACAATCGATGTGTGGGAGTTGCGCCAAGTGCTGGAAGGTAGA
AAATTATCGCCCGTGTCTTGGTTCCCCTCTTCTCATTTCCTGAACTCCCTGTTCATTGTAGCAATGGGACAACAGCCAACTGAGGAAGAATTGTTCCAGA
TGATCAGCGAGGTGGACGAGGATATGAGCGGCGCTATCGGTCAGTGACCCCCGAACTCTAGTTTGCTTTGAGTTGGGTCTGTCTAATAGTACATTTGCTG
TGGCTGCGCTAGACTTCGCTGAGTTCTTACAGGTGATTGACAACCAAAAAGATCGAGCCGCCATGTTCGAAGACGACAGCGATATGAGTGTGTATAATTT
GTTTGCTACTTAAGTATTGCACATATACCACTCGCACTCACACTTTTATTCTCGCAGTCGACGCGTTTGTTGCTTGCGGTGGCAAGCCCGACAAGAGTGG
ATTTGTGCGCAAAGAGACACTAGTGAAAATCATCAAGGGCGACTTCGGACTGACTATCAACATCGAGGAGATGATCAACAAACTGGACGTGGATGGTAGC
GGCGAGATCGAATTCGATGAGTTCAAAGCGATCCTGACATAACC