Description :
From Genome Similarity Track
Location :
Scaffold_19:240244- 249522
Transcript NameFunction/comments
Phyca_LT1534506333Hypothetical protein
Phyca_LT153416294GPI ethanolamine phosphate transferase putative

Sequence
9278 bases(100 bases per row)
cacaaaggacagcgatgccgatcttcagagggcagcgtgaataagcactcctcataaacaacgtcaacaatgtcgcgggcaattccagctcgcacatcag
cgtgaacgaccaacacttcgcgcaaaaactccaagaacccgataagtacttcgcccgaacgctcgttgcaagcgaggaacttgctcgaaaaaccacgacg
aagcttcgccacgacagcctcagcaagcttttgacaactcgaagacgtgttgccattttcaaggcgtgccaacgagcaaagcatctttgtgnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnctctacctt
attccctaggcgagtgctcagcctgaggcagattggaaagtgagctcgtcctcggactgcgtcctcgggcgcgctcgacctctgcctccaagtcctcatc
gcacggctggtggcagggctctctctgcctgaggctatccaataacttggaacacctcttgtaagtaccttagctggaacatgttcgctggcagagtaca
acccattatcgtggcccgaatcgaagaggcaaaactttagaatacggagagctaccgcggcaccttcattgaaagagctctcgtggaaattggcgttaat
aaaatatgatagcacttcgtggaacccacctccagaaatgaaacgttgaagatacgtttgcgcgaacgaaaccttagcgacatctgatgggagaagcagt
gcgtccataatctgcagtgtgtagatcgcctggtgggatgagattccttttacaagagacgaccaatcgggtttgcttcctccattagctgggtcattcg
agggggagctcatattcacatctccgccacctgcttcagtcgcaccaatattggaaacccggttcagcaactcctcgctagtcggaatctgcttcaaaaa
ggcccacaacaactcgtgcacagaatgaccttccacaatgtcaagcacgcggaacaaaactctgaaatatgaggcatcgcgggcaatcactaggccaggg
tggtgctcagccaaggggggagaagaatccttgcctgctggttgttcgtggtccattacactggaactagagcgctgcacaaccgagttgaacattagta
cgcgcagctcactggactccgtaatatccaagtcagcgagcgtcttttggtcgcctgtaatcgctgacccggatgagaggatcttcgtctgttgcatggg
gtgccccactaacttttcaatttgcttccggaattgccacagcgtctggttcgagtacgctggtgcctgcatagttcgtacattatcatgggttccagct
gatgcccccgatgcccctgccccactcgcattggaagacgggatccgctgagcaataaccttgattgtaaagtacgcgccacgcccactgagaccatgcg
gaacaaaagcctgcttcttgtgagcactagacaccagcccagtcaatagactagagcattgctggactacgttcaatgagtccggtgagctgtcctccac
tgtggaaagttgtttaaatacacgcgccaagaaatcttttacaccttcatccgatttgtgagaaacctcgtccgacgatcgctcataaacacgaagcagc
tcacgtgtagccatttcggcaacttcgagaggagcttcaaatgcgatgcgccatagagcatccattccgagcagattcagcatactggtttccgaagtat
cttccactcgctgcaacaatttttgctgcgcatttagtcccacaaagtatgtattaaagcatttgtagcccatgcacccaagggttcggaaatcggtttg
cttgcacaaaagctcgtgaagacgtagaagcagacgtccaagttgaaggctgagctgatagacccaccaaccgtgcttgtaccagttgtcccaccttgtt
ggtgattgcgcaggcttgtttggttgaaaaatatcaaacagaactcgcgttcagcaggtgaagaagacagtacctcccataagcgttcgatctgtgggat
cgaaagttccaagtttggcgacttcacgtgaacgtagtgaatcaattctaagcggtgaccgatagccgtgcgatagctcggggagtgtttatccgtactc
cttgccacaaacgttgcaagctcgtcaaataacaagctcaccaatccatgctctgaattgagtgactccaccacaagagcctggtccattcgatacgagt
cgatcaggaatttaagcagctccaacgacttcgaggctgtcgaatccttactagatagttccgctgaagtaactgatgtaactgagctggtactgccagg
tgccgggggaatcgtagaagacggagatgtagcatctgatggcgagcttgacaacgagcaagatttcttaattccttcaatgcactcgtttaagaatgcc
tttcgtaatggctcgccgtattcgctccgtagcccttcttgaaaaaaatcacgcaagctccggcttagtcggatattagcgatactgcagtgcatttgaa
ttgaccagagtaactgcaggattgctgttgtgacgttcacattgcgctccatgaggaagctcggagagctcgtcgccaatcgctgcaagaacgaaataag
ctccgggaaaggctcgttcttttccaggtttcgcaataacgaagcatggatgctttccaccagatgcaataacagttcgttcgacagaaacggcaccgta
gcgatcagcaggttgtgaatttcatgaaccagggtctggtctttttggatacaggactgccaaatgacgtcaatagcacgtgtatccaacttgttggatt
ccgctaaaaacttgaccaagagtgcactgcgcgatacaatctcacgatggattctgtcgccaaaaatctcctccagaatctttttctccacaacccaagt
actcaatatgtaatccaaacgggtacggtcttcatcgccattttcttgaacactttctgcaatcagttctggagctggcgcctctcccttccctgtggga
atccagttgtgtgttgggggcaaggactcttcgtactgcgattggtgctggtaataatcgatatcttggtcagatccaggctgcatcttgtcagcctctg
agataaaccaccacttcaagccactcttcatcgtgcagcagaagagcgtaaacacctggcccgtttcttgctgacggaatacgtacgttgccgacgttga
gttgtccttcaacgtgtacacaccgttaacagcagctgtaccagcgtttcgtacaaagtaccgtggagggaaagcacgcgacgcacgagcgcagttgacg
atctggttaatttgttccaagccaaagagccgcagtggcaatgaagtcgattggacgtatctctcggtaatgtcgagccacaatgaattaacggcttctg
acgagacaatgccagcgtcaacgagcctccgaataatgccaattacggcccccacagcgtcacttgactctttctttaatactgagtcggatatcttggt
gaagtacgtcataatcagcaccgagatcttcgtgcagatggtttctggaacagatgtcctgaactccagcagggcctgcaacaagattcggatatcttca
ctatccatagccgactcgagatcgtctccttccctgtggttctgcatgagcatctccagcgtactcagcagcagatggaatcccttcatctcgcaaaagg
cttcgatgcactgtgcacgcacttccggcgaccctggcaccttgttccagtagcttccaatcatagctgaggtgcgtagatccttgtaaaacgtcctttt
cttgctgaacaccatcgtgagcaccggtagagcctggaaatacttgcccgccttcatctgagcaatggccaaaggcaccgcaagagacaagcactgcgta
acacaggacttttcaaaggagccaatcttgctgccgtgctgatccaacatgatgctgatgatcttctggaaggcatcgtccaggaaggcctgactctccg
gccgctccaagtgctggtacgctgagttgagcaccttgactgcgttctgccagcccacagtggacttgaggcgcagatcctcctgcaccacgtggaagag
ctcaagctcgtcgtcttccatggcgttggagccgccttcctgactcttcttgcgacgtttctggctgtccttgtcctgggcgggtgcgcgttccatcgag
cgctcgtgcagcttcttcttgtcctcctgcgggctctgactggggctcgctatggtgcaaacggtggcgaggcggtggcccgacccgcttctgtcgctta
agttgctgcagcgttcgctgacaaagttgcggcagggctgcttgaccttcttggtcttggtgctgctgcccccgacgcttttccgcttccgccgccgctg
gccgtcgtctgtcgtgcttcctctgggggagatggcgcgtctccctctgccttcaactgagctgtggggcgcgtgagacgcgtcaaggaacgagacgcga
gcgcgggtgcttcttgccgggtgaaagcttcttcgcgcaaaaagagggagccaagatactgcggtaccggttgactaccggtattttagaaatcagggtc
gagcaacgtaaggcttttcctcgcgcaacattaacattcattccgaccatggatcgacttgaagtgcgggctctagtgcgcgctccggaacgtgcagctc
ctgcggcccctgtggaccgagggatcaccgtagatgagtcattagatgaagaaacgttccttaagacgctggaggaaacgctacagcagcacgtggcctc
gttgtcgcagcagtttcttgtacttagcgagtcgcaagtcgcaagtctggctttccgtctgcatgacgcgctagtacccaaacgcgacgctgatacgggc
gtcatacaggcgtggacaatacagccgcagttgcagctcaaggtcaaggccagtgcgcacatccaggtgcttaaactctccactatactgcgcgaagtac
agaggctgcgactgcatcaatgtcatacggatgaagaggctgtaggagatcccattgaagtggagattttcccttctttaagggtaattgaagcccttaa
tacggggagcagagggctgcagaatgcacactactttgctgctcaattgagagagctacacattgaacacactcaagtgacgacgttgcgtgagttgttg
aagcccgagcagcaagaaaacaaggtttggaggaagctgttgaagctacagatgaactgctgtgacttgcaggtggtggatgcgtctgtgaacttgttga
gagctgtgcggactttggacttgggttggaaccagatcaagacgttcgagacggacgtcaccacgaagacacttcaagtgctgaatttgtgtcataacca
gctgaagctggtgccaccgatccagtctttaagggggttgagagaactggatttagcagtgaacggtattgtgtcgctgaaagggttggagaaactcact
gcactggaacgactcgacatctcgcacaatttgatcgatgatatcgcagaggtggagctgctcacgggactgccgaagttgacgtatctgaagatggagt
tcaaccccattgctcgaaggccggactacaggcgagaggtgctgttttacttaggcgagccgattgagctggatggtcagcgatggaacgatgctgaggt
tagcagcatggcttatcgacgcatgctgatgatgctggatggagagaaggagcgaaatggcgaaagcagcatgtggggacagacagtcggggctcctgcg
taccccaaagctcgtgttcgaagtggaatcgtcgtgaagaaccccaagttggtgctggactatccggagttgcctcgatctcaagatgctcctgctcact
ttgtcgagatacaaaacccaccatcagcgttaccgataagcagcaagcgcttgaatagcgctggtgttagtgaagcagaaagaggacacagctccatgaa
gtccgcactaaacagtcatggagctcaaggtgctcgtccaacatttcgaactgttgatgagtattttagaacgcagcgcgatgttattgtgtcgaaggct
aaaaaggaaaggggtcaaaacgaggaccaaacagcaacgagtggtacggtacatgcctctgacgaatcctgttcctatgtgaatttttaatggttgctat
gtggcgcaggggaagacagtgatgaatccaacgccgaaaagacgaggaaacggagtcgcaaatacacggcaagtgactttatgcgcgactttgaggaaga
ggagttgctcgttcgagaaggcaatgatattgacacagtcggagttcccgctggacgctccacctcggagactcagttatcgagccctcaggtactcttg
cctttatacttgctttcgtggtcaattaacatgtaagttatctctgttttggaatggctgtgtcagaaacctggacgtaatgtcaatgtccgagttttat
taagtgcaaaagaagctgctgagcttgatcttcactttggaatcgatggcgtcccagcaaacgtagaaattaaggtacgttggatagtttctcgaggaag
tgatgcgcggctaagtaggaattggtgcacttttctgcagtcacgtgaattggttgagaggtttactgtcagcgatggcaaaggtccgatagcgatcact
cgatggcttccagatgttgccgctgttggcgtttcaatgcactcgagccgcgcgaagatcatcatgatgaagtttcgatctcgaggttcaaccagtgtag
cggatgctgcttatcaatttgacgcggttgtagcattggagactctgttttcctggctggtagctcgtctgtatcagcaattcaaggggcacgtcgtgat
ctgcaattgtgttgattgtggagctctttccttactcacatccaagtatcctgcgcggtcagaagccgaggacgctttgatggtctattcgtgcttgttt
tgctcaagttgcaacgtgcgagaaataccgttcaagaagctcgttgcgatatgtgtcaacgaaggagtgacgatcccaagcagcattccgctggcaccgc
caccatgggagatgattacagaagggttttacattgaagaaccggcgggtaccgacccagggatgagtgactgtgtcatggtgtcatacaacggtattcg
tgaagttgcagtccctcccgctgatgtgggcgcgagcgatgaagcgcacagcaacgagatcagcgatgctattgtgcacgcgatgacttcaacgataaga
tgaaagcgcttgacacaattctctttactctaattaatgttctctggttgaatcgtggctgtggcaaaatggtgctagcagtagaagcaatagcacctca
gttatcagcaagaccactccatcgtagatatacttgggtgcgaagatggcccaaaccatcagatgtcttcgctgcagcgcaacaaacagcgttgacacca
aagcgttgagagagaaataagtcgaaaaggctaggagaatttgaggttctcctcttgctttctgctggtgctgcgtcaagttaatccagggcagtgcaag
tacagccaacgccaagcacccgaaagtgttaaggccaagcaaggctcctgcagcgtagaagttgaaggtgtcgaagcccacgaagcccgcggcgttttgt
aaactcgtaaatgtgtttgcatgtcccgttgtgaaaaatgcttgatatgagaacgaggcccagagcaaaacccacggcgtgatactgccaaatgttgctg
atcggcggcaagttacaacgaacgcaaagctgaggcattgcaccaccagacacagcaccgacaatggggacgtaggtccgagcacgagcataaatgccgg
gacaagcagccaaaacaaggagacgtgagcactcgcagctgacccttttcctcttgattgtcgtagattcacaaggactccaacccctcctaggaagacg
agataaacgaagcgcggtagccatagtctccagaatttcacgttgattggtgaagcagcccaaaagactgcacacgcacagtagctcatcaacgatgctg
cgagcagcactcggcctgttcgcgatggcttctgcccggtgttcttggtcatcaaagcaggggagacaacagcgagtatcgcgataacagccagcggtgc
gaacgttctctccaacgtcgcagtcgtcttgatgatattgggcggttccaatgcgctactgagtcgagttgcaaagataaaagtcagcgcggcagcagcg
gcagcatgccgattgacgtccaagcgctgcgagaacgtgagtaagaagaagcccgtggttgctgacagaaactgcatcacattgccctcggccacgatgt
agctattggagagcagtgcgagtgcatgaagcaccacgacaacagtgcttacaactgctggcatggaagacggcagatagtgtacacgttcttcagagtc
ttgaacactcgtggggatgcatttaagtcgagatgcgagttggcgagtcatatcaaccagacccgtgaaagaagctactgctagtgcacgtgacagtggc
gcagcgggaagaagcggtaggataatgctttctgggcagcccaggaataaaccacccgtgacagcgacaagaccgagcgaaggactccatgaatctcctt
cgacaccaccacaggcaactcgagtggatacgacgccaacgatgaaagcccacgcgagaatgagcatcccccaacccatactgcagagatcgaactgcgt
ccagatggaacggcctagcgacaatgcttctcgcagatagttctgctgttgctttgcaagatcttcgtgaaggcgaagaagcaacggaaggtctgctttc
acgtacgatggattttctccacttccttgcactttaccaagttgctcttcgacttgctggatgtccacaaaaagtttctccagctgatcgtatgctcgct
caggtagtttagaggcggatgagtatctgaagaggtatcgccttacctggtcgaggttcaagcgtaaagctcgattcaacgtctcgaacgctgtcaatgc
tgtgttccttcctgtttttgatggtgaaggaacgaaaaacagcgacggaattacgctgccaaggttcccaaacggaat