Description :
From Genome Similarity Track
Location :
Scaffold_516:2402- 10520
Transcript NameFunction/comments
Phypl_g9069hypothetical protein PHYSODRAFT_337674
Phypl_g9070hypothetical protein PHYSODRAFT_285823
Phypl_g9071hypothetical protein PHYSODRAFT_503133
Phypl_g9072hypothetical protein PHYSODRAFT_352121

Sequence
8118 bases(100 bases per row)
TCGGAAGACAGCTGGAAGAGGACGCTTGACGAAGATGAGTTCGAAGTCGAGCGGGTCGCAGACGTTCGATCGGAGCGGAAAACGCGGTATGGGTGGGTTC
ATCGGGAGTTCCAAGTGTTCTGGAAGGGGTATCACGGAATGGCATGAGTGGACGAAGCGAACTTGAACTgtggcgcgctgctgcgcgagttTGAGCGAGA
GAGTGTCAGTCGGAATTGGTTCGAGATGATGCAGTCCCACGAAGAGGGTGCGGGCGACTCTTCGCAGTAAgttggctgctgcgaagGAGGAGTGAGCGAG
TAACGAGTGTGCGGGGTGGCCGCACATTACGTGGAAGGTTTACTTGTGAATGGTGAGTATTGATCGGATGGTCCGAACCATCCCGATCCGAGTCCGGAAG
CGCTCCatgcaagaagaagaatgaCTCTTAATGTTGGTTACGCCAAGCAGTGCATCTCGGAGGGCATCAGCTACCTTACTTCCAGAGCATCAGATGCGGT
TCGCGACGGTCTGGAATTTGCCTTTATGTCGcgcgaggcggtggagcggTAGTGATCGGCTACAACTTGTTGGACCTCGTGATGGCGTCACGCAAGATAC
TGATCGATCTGAACTTGAGGTCGATCAGGTCGGACTGAAACGGGTGGATAAATATCCGATACGGCGATcagaagttgaagttgggCTGCATCTAGTGCAT
GCCGATATGTTCCCAGCACTGGCGTGATGGCTCGTGATGATATGTGCTGGGCACGGTTGCACCGTTGGCCGGTCTGATCAATACGAGCCACTGCGATTTG
GTACGGCTGGTATTCGATTGacttcaagcagcaagaCCTGACAAACAGTCGCATCGTCATGACGGAGAACTTTCAGCCTCACTACATACATGAATGAAAA
TAACGCGATCTCGTACCTTGCTCGATCTAGAACCGGGATCGTTAGCGAGTCGTCTCGCTGGGGTCGATGCAGCGGTCACCGACAGTGGGTCGGGCGACAA
CACAAGCTGGATATATACATATATATATGATCCTGGATATCCTGAGAACGTGTTCATCCTGCCCAGACCGCACACTAGCTCGGTCAGTGGGCCGATCGGC
GACAAGTAGATTGCCGACAACGTAGACGATGACCAATTTTGCTGGGAAACGTACCAGGAAGCGTCAGGGGAGctctggggggggggcgaaCAAGCTTGGa
gtcacggcgctgcagaagagTCAAGGGGGTGCGCCAGGTTCGAGCGCTGTCCGGCCACCCCTCGCGTAAATGGCGGCTCTGGGGAACCGCTCGCAGGTGA
AAGTGTGGGAACGAGTCAGTCCTGGCCAATCAGGGCATTTCTCGGATTTAAGCGGGGTGATTGGTCGCCCGCATGATATGGGTTAGGGCGAGCCTGAATG
AGTTCAAATCGGCCGCAAGCATTCCTGGGCGAGGCCGATCAAGTCGGGCCAACATTCGGGTACGACACTGAGGAAGCGAACGTGGCGACGGGAAGCCGAG
AGACGAGATGCGCGGACTGACTGTtatgcagcagcaggtcctcgtACAGGGGGTGATTGTGGTGGAGCGCTTGCGGGCTAAGCCGGCGAGACGGAAAGGT
GGGAATGCCCGATCGATCGGGTAGAGCTGAAGGTAATCTTGGTTGGACGCCTAGGGCTGCTGCCATGAAATTTCTACACAGGGTATCGTAAGCTTTGCGC
ATGTCCAAATACAATCTTGCTGGTGAGTCCTTCCAGTCGAGGTCGGGGTCGTCAATTATCGCTCTCAGCAAATGCTTGAACCATTGTAGTGCTTCTAGTC
ATGAGTCGGCCTCGAACAAATCCTTGCTGGCCAGAGCTTATCAGGCGCTGAAGGAACTTATGTGTAgcggggttacattcgggtaacaaGGTTACCCTCC
CGAAAGTGATCAtatcactttctacatgGATACATATATCATTGAAGCGAGAACAGTGACCAAGGATCCTGAGAGTCACTCAATCATGGCTCTGGGCATT
TTTATAAGTTTTACTATAGGTGTTGTacagtttgtattgcaggacaaactgggCTCTTCttaaatatattcagtctttCTTTTACCTTACCtttggtacc
agtccccttcaggccagggactagTGAGCTACCGTTgactgggagtttgtataaactccgaagcacacacttcctctgtgcaacgtgcttgtgtgacagc
ccgtcacgTTATGAATGCGGTTCGCATAGATTCTTCCGGTCGGTAATCCATTGCATTCGTGGGGTCACCCTTTTTGCGGATCGGGACTATCACCGCATCG
AGGAAGGACTCCGGCACCGGAGAACTTAAAGGTACACATGGTGTAACATGAAATTCATGCTTACGTACGATCTGCTCGGTGCCTTTTATTTAAGGTCTGG
AGCCCAACACACGTTATCGTTTCCGTCTCTGAGTCGTAGGTGCTCACGCGTTTGAATGGCCACATGCGTTGGGCGGCTGCGACCGTGGTGGCATCCCGGC
CCGGAGTCGCTATCAGTTTTATGGTACTTGCAGGATATTTTACGTGGCGGGCCTCCCTTAAATAAACTGGGGTTAGGGTCCATTTCGCTTGCGACAGACA
GACAGCCAAAGCTGGCTCAGAGCAGCAGATTCTTCACTTCTGAAGCGCGTCTCCGTTGGCCTTAGAGAGTATGTACGTAAAGTTTCAGCAGGATCAGAAG
TGGTGCCATTTAGTTAATGGAGTTCGTTCAGAGAATTTGGCGTTTTTGTCCTCCTTGTCTAGAGTTTCGTGACAATGCCTTGGCTCGCAGAGGGCTCGTC
AGTTCCGAGAAATAAGTGAAAGCGATATTGTTTGTTAGGTTGGCATGCCCAGTGGACCTGGGAACATGCCCGTTGGACTCTGGGACCAAGACGGAGCGAC
AGGAGGAACTGGCGCAGGATGAAGCCGGGTCTCAGACGCGAGAGCCAAACGTAGGATCTAGAAGTAGCTCATGCTTGCAAGCTTAATTCATTCTCTTTTC
ATCTTCTAATCGCAAGTGTCCTCACCCAATAAGAGGCCTGAAGCCGATTGCCCCTCTGCTAGCCAAGGACTCGTCAAGATCTGTGACCACGAAGGCCTTC
GGGAGAAGAAACAAAAGAAAAATCTGGGAAAATGTAAACTAGAGACACGTACGCTGCCATTGCTCAAAAGGCAGCTTCTGCTAAGCTGGAGATCGGCATC
AACTGTAGCATGCTTGGCAGTCCCCTTTCGGGGTGAGAACCTCTGTTAAAAGGCACCTAGCAGATCGTACTTAACCGGCTGTTAAAACAACGCTCCATAG
ATTTTAGTGGAAATTCACAAAGGGGGATTCCCTCAAAATCCGAAATTGTACGAACCGCTTGTTAGCCTCACCACCAGTCGAGATCAAGATGGACGTGGTG
ACGCCTGCTCAGCTGGAGACTAAGATCCGCCGCGAGATCGGAGccgcgctggtggaggccGCGGACCTGTCGGACGGCTGCGGGAGCAAGTTCagcctcg
tggtggtgcaCGAGGGCTTCGAAGGTCGGTGCAGTGGGGGGCAGGAGAGGGCGCCGTCTCTACCGGCAAAGGCGCTAACCGGCCTctctgtctgtctgtc
tgttGTTTCCTTGTGCCTCGCTTTTGCCCGCAGgccagtcgctgctggagcgccagcgccgggtGAACGACTGCctcaaggaggagatgacgcgtatcca
cgcgctgcagatgaaGACGTGGACGCCCGCGCAGTATGAGCTGAAGACGCACAAGAAACTGCCGACGGTCGCCAACAGCCAGTCCTCGGGCGAGCATTAG
ACTCCAAATCAACGAGAAGGTTGGTCACTCGTTGCTGTGAATGTCATATATTGAGTTATGTGGGGCGGGCTATCACAACTGCAAGGGGGACGCGACGGGG
GACGCGACGGGGGACGCAGGCAGCGTGGCGGACTGAGCCAACTCGTCCAAGCTCAGGCTCAAGTCGCCCACGCTCGTCTTCTGCCACTGAGAAGACGCAG
AGGACCCCGACGCCTGCTCCGCGGTGCTTGACGCCCTCTCCCCGGTTGGTTTGACGATGAACCGCTGCGCCCTTGAAGTCAGCGGAGACGACAACGTggc
gtcggagctggagctgctggttctaGTCAGCGAGCCGAAACTTGGCCATactgaagaagatgagggCGGCGGGTTACTGGATGCCACACCATTGCGAGCA
AGAAGAGAGAGTGACGGAGCATTCGAGActccgttgctgctgctgctgctgctgctagtgtTTTTCCGCGGACTCGGACTCTTGCCCTTGTTGCGGCGAC
CGGGAGATGTGCCGCCTCCGAGGTGCTGGTAGCTCTCTTGGCTGCAtctcgccagcttcttgtagaactcgagctcgtcggtGAGCAGCCGGCACTTCTC
CTGCGACATAatgatctgctgcttgaacaGCCCTTGGTACTCTTGCAGCGAGTTTTGGAGGCAGCCGATGTGTGTTTCTTGATTGCTCAGTCGCGTCTCG
CACGCGCGGTTCTTCATCTCGAGCTGACTGCATGCCACGTTGCACAGGTTTGCCTGGAACTCCAGCTCCTCAAGCCGCGTCTTCAGTCGCGCATTCTCAA
TCACGATGTTGTAGCTCTCGCCGCTTAGTGATAGCCGCGCGTTTTCTGAAAGATAatgcagctggagcttgaGCTCTACGATTTGACGCGATAATGCCTC
AGCGTCGGCGTGGTGCACGCAGTCGGGTGTTGAGCACGGTGGAATTGTTCCTTGGAGTGACGATAGCGAGGCGAGCGTGATTGTCTCCTTAAGCGGGGAA
GCTGCTTTCAATGCTTCCTGGGTAGTTGACGCCCGACtagccagcagctcaccagcgctgctggGGACAGGGCTGCTTTCCGCGTTGCTATCaggctgct
tcgactgctgcgcATAGTTTTCACCCTGAGCCTCAGAACGAGACTCGAGTGACTTTCGCCAGTTGTCGCTCTCCAACCACACCTTGAgtgacggtgctgc
agcttctcgagatTCTACGCTAGAAGTTCTGTCACCTTCTATGGCACTTTCGCGTTGGCTCGAGAGAGTGAGGATCGGCCTGCCAGTGGACAAGTCTATA
GTaacctcgtcgagcttcttctcgagaGCTTCCAGCACACCAAACAGCCGCTTGTTCTCTTCCTCCAACGCTTGAttcgccagctcgagcttggtGATGT
TCTTAGCATCGGTCTGTGCTGGGTCattctcttcttcttcgtcatcaaCAACACTGTCAccgtcctcttcttcctcgttATCACCGTCCTGGCTAGAGTG
ATCTCCATCAGAAACGTCCGTGTCCTGCttgccagcttcttgcaccgTAGCAGATGATACCCCACCTGAGCCAGACACTACTTCATCGGGGAGCTGGTTC
TCCTCGTACTTCGCAGTCAGcagtcgctgaagctcgtcGATTTTGCGATTCTTCGCCTCCATATCCTCCATCGCACGCTGATAGAGCTCCTTAAATAAGA
TCCCCGCCGCAAACCCCGCGCCACCTTCACCTCCGTCGGTCCGCTGCACGACCGGattcttgatctccttcgcGCGTAGGCCGAAGCGAAGGGTGGAGAT
CGTTTCGGGCATGTtgtacgagctgcacgaggccgcAAGGATGAGGCAAGTTTTGGCAGTCCCTCCTAGCGAGTCCTGCAGCAAACGTGTGAGCTTGGAG
TCGCGATAGGGCACGTGGCGCTTGCCGTCTCCAAGCGCCTTGATGACATTACTGAGCGCCGACAGTGACTTGTTGATCGCTTTggcttcctgcagcaccc
gGCCACTGGCATTGGTCTTGTTCACGAGCTCAGATCCGGCGAGGTCAACGATGTACATCGTGGCTCGTCTTCCGCTCACGGGGCGAACACAGGAAAGCAT
CAGGATTGTGTGGCTGCGACTCGAGTCCTTGTTCATGCGCGTGGAGGATACCGCGCGACTGAGCGTTCCgctcttgacgagctccatCATGGCAGCCTCG
GACTTGCTGGGGATGCGTGTCATCTCCTCGATGTAGACACCACGCTGCGCGCTCTCGCGGATCTTGAGCCCGCCGTTCGTGGGAgtgccgatgctgctgc
tgctgctcggacCGAGCAGATCGCGGATTTGCTCCATGTAGATCTCCACGAACGAGACGTTGAGCTCAATGGGGTCGGTCTTGGCGTGCTCCACTTCCTC
GTAGAGGTCCTTGACGACGCGCGAGATGATGCCGCCCTCTTCATCGGCGCtcaccagcacgccgtccttggGCCCCAGGATCGTGTGCGTCTTGCCCGAG
CCCGTCTGTCCGTAGGcgaagatggtgctgcaACATGTGCACAACAACAGAGAGTGAGTGCGCGGTCGTACCAGCAAGAGCTACGGGGGTCGGCGGCTGT
ACCAGTTGTAGCcctgcaggaactcgtggACGAGCGGCTTGGCCGTGTGCGTGTAGACCTCCTCCTGCGTCGAGTGGACGTCGAAGACGCGGTCGAAGGT
GCAgcggatctcgtccacctcgcaGCGCTCGTTGCGGAGGAACATGGTGCGGCCCCCCACGaccgtcgtgctgcagggGAAAGAGCGGGCGGGGGTTACG
ACTGGCCGGAGGACAAGAGCGGGGGGCGAGAGGCGACGTACCATtgcacggcctcctcgcgcttctcgagctggttctgctggcgcaggcggcAGAAGAC
CTTGATGCCGGCGAGCTCCGGCGGCGGGGCGCCcacgctcgaggccgaggcAGGCGGGGAAGCGTTGGCGGTCATCctcctgctgccgtcgtccatGGAC
AGCAAGCAGGCAACGCGTCGCGGGGCTTGCAGGTCTGTCGGCAGGCAAGCGGCGGCAACTTGGCCCCGTGCTATCTTCGGCAATGCGCTCGACTATAAAT
AGTGggggcaacttcaacacgtcgAGCTATTttcggctgcagctttgGGAGTCTTATTTTGGCTCGCAGGCGAACCCCTGGGCCCCAGTCACGGCCAGAG
CAGAGATGACGCCAGATTCGTCGGCCCAGCATTAGCCAGGCTCTTGAACACATGAACctccctgcagcagctcaccatcgtccgccgccgtggcgctaAC
GTGATCGGcgttcacgagcgccacTGGTACCAGCGGAAGGCGTCGGAAGCGCCTCTTTGCTGCAGTACGTAGCACAAAGAGATTGTAGCACAAAGAGACG
TCTGGACTGCAGCTGAACCCGCTCAAGGCGATCGAAAACCGAtcacgccggcgccgctggcCAATCGGCGGCCGCCAAAGCAGAGCTAGGGGTGGTGCAA
GTGTCCTCCGCGTGATGTCATCTCCGCCCGCTTCCTGCTCACTCGACGAGTTGCCGCCCCGCGCCGACTGCTCCTGGACGAATCTTTCCCATCCCCTGAG
ATGGTCGCCAACATGGAGgagagcgccgccgcccagctgcgccccaacgccgccgccgcctccaagCCCCAgcgcgcgacggcggagcGGCTGATCCCGA
cggacgtggacggcgagttcgccgaggaggagggcgagctgttcgcgcccgaggagcaggccgaggcCGGCTTCAAGTGGTCCGAGGTGGTCTGGTACAA
CGTGGTCGTGCTGGCCTCGTGGCACGCGGGCGCGCtctacgcgctgctgttcgtcgtgccgcgctgctcgctccagcagctgctcgtgctctggctgctg
ctctgggTCGCGGCCGGCCTGGGCATCACGGCGGGCGCGCATCGCCTCTGGTCGCACCGCGGctacaaggccaagctgccgctgcgcgtGTTCCTCATGC
TGTGCAACTCGATGGCCTTCGAGGGCACCATCTTCGAGTGGTCGCGCGACCACCGCGTGCACCACAAGGGCTCGGACACGACGGCCGACCCGCACAACTC
GGAGCGCggcctcttcttctcgcacATGGGCTGGATCATGGTACGCAAGCACAGGAACGTGCGCGCGgccggcaagaagctcgacttctcggacctgctg
gccgaccCCGTGGTGGCCTTCCAGATCAAGCACTACAtcaagacggtgctgctcatgtgCTATCTCGTGCCCACGGCTCTGGGCTACTACCTGGGCGACG
CCTGGGCCGGATTCTGGG