Description :
From Genome Similarity Track
Location :
Scaffold_313:2402- 4756
Transcript NameFunction/comments
Physo_125630OSIGBa0102O13.1

Sequence
2354 bases(100 bases per row)
AACGGTGACATACCGATCGAGGAATGGACACGTCTGTTGTACGCGAATTCGGCGAGATGTAGGTATTCATCCCAATCATTCTGGAATGGGTTCACGACAC
CTCGTAGATAGTCTTCAATAAACCGATTAGTACGCTCGGTCTGACCATCCGTTTGCGGGCGGAAGGCGGACGACAAGTTATGAGTCGTCTCTAATGTCTT
AATCACCTCCTGCCAGAACTTTGATGTGAATTTCGAGTCACGGTCTGAGACGATCGACTTCGGCACTCCATGGTCTTTCACATAATTGGCCATGAATAGC
GCAGCAGTCTCTTCTGCTGTCGCCGCCGTGTTCGTGGCAATGAACTTAGCACGTTTCGTCAACCGGTCCACAATAACCATAATGGCGTCTTTTCCGGCTG
CCATCTTCGGTAGTGCAACCATGAAGTCCATCGTCACATCAATCCATCTGCCTCCTGGAATCTCCAACGGTTGAAGTAGTCCCGGCGGCTTCGTTTGGCG
TGCCTTGTTTCGCTGACAAAGCTCGCACGTGTTCACATAACGCTGAATGTACTTCGACATCTTGGGCCAGTAATATTTCTTCTGGATGCCTAAGTATGTC
TTGAAGTACCTGCCGTGACCACATCGTGGTTTTCACAAATAACACGGTTCTTCAGATCTTCATTGTCCGGAATTACCAGTCGTGCATTTTCATCATCTCT
CGTTTGGTAATACAGCAGTCCATTCTTCACAGAGTAGCGTGGTACCTCTTTACCACTAGCGATACTCTGCAACAGCTCCTGAACTCTTCGATCTGTAGGG
TACAGTTGTTTGGCCGAGTGCGTCACAGTTGCACTGGTCGTTTGGACGCTAGCTACAATTTCACGGTTTCGAGCCGCTTCAATGAGCTCAATGAGACTAA
CCTGAGCGGCTTTGTGCTCAAAGAGTGGGTTTCGAGACACTGCATTGGTTACTGTCGCCTGGAATCCATTTGAACTGTGGTTGGTCGGCTAGTTCATTAA
ACCAGCGAGCCACACGACGGTTTGTTGTCTTCTGCGTCAATATAGTCTCAATACTCTTGTGGTCTGTCTCCACCGTAAATGGCCGATCGAGCAGGTAGAC
TCTCTACACCCGAAGCACATGCATAATAGCCGGCAATTCCTGTTCGCGCACTGGGTAGTTTAGCTCCGCTGGTTTCATTTCACGACCAGTGAATGCGATC
GGATGCTCGAGCCCTCCCTCGTTTTGAAACAAGACTCCCCCTATGGCAAAGTTCGAGGCATCCATACGAATACCGAACGGTTTTTCGAAATCAGGAAGTT
GCAACACGGGAGGGGTGGAGAGACGGCGCTTGAGTTCATGAAAACATTCCAACTGGTGCTCAGACAAATGCAGCGTTTCCTTTGGGCGCAAACCCTTAGT
ACTTTCATGCAATGGTCCTGCGAATTGCGCGAAGTCGCCGCAAAAGCGCGAGACATAGACCGTAGTACCCAAGAAGCTTTCCATTTGCTTCTTTGTCCGT
GGAATCGGCCACTCGCGAATCACACGCACTTTGTCAGGGTCCATTCGAACACCATTGCGGCCCACAAAATCACCAAGACAAGGGATCTCTTCGACACAAA
ACTGGCACTTTGACAACTTGACATACAGCTGCTGCTCTTGACAGCGTTGGAGTACTCTGTCCAACGCTTCGACATGCGTCCGAACATCTGTGTCTTGAGT
GAAAACATAGATGTCATCAAAGTAGATGCGCATGACATCGCGTAGGTCGCTAAACACCCGCCGTAACAACCGGTTAAAAGTGCCAGGACTACCGCTCAAA
CCCATAGGGGTGACAAGATACTCAAACAGCCCATCGGGCGTCGAAAAAGCAGTAAATGGAATGTCAGATTCACGAAGTTTAACCTGGTAATATCCCCACA
AGAGGTCCATGCAGGAGAACCAGTAACTACCCCCATTGCGTCGAATGTGTCTTCCTTCCTCGGCATGGGTATGGCCGGCAAAATGGTAGAGCTGTTGAGC
TGGCGATAGTCGTGCACAATACGCCAACCCACGGGTTTCTTGACACAAAAAGTTGGGGCACTGAATGCCGAGGTGCTAGGGCGAATGATTCCAGCCTGTA
CCATCTCCTTCGTCCAATCTTGGATGACCTTGCGCTGCTCTGGGCTTTGGCGCCACTGTTTCACCGAAATCGGTTGCGTTCCCGGCTGAAGCTGAATTTC
GTGCTCAATCCCTTCGCGGACAGGAGGTGTGGTACTCGGCAGCTCAGTGCGAAACACAGTATCGCGGTACTTGAGCAAAACATCATATGCCGGATTGTCC
ACTAGCGCCTCCCATCCTTGTTGCTTAAAACGCTCAGCCTTTTCTGAGTCGTGC