Description :
From Genome Similarity Track
Location :
Scaffold_46:24019- 25344
Transcript NameFunction/comments
Albla_Nc14042930conserved hypothetical protein

Sequence
1325 bases(100 bases per row)
CAGTATCATCAGCCTTCGACTCGACATCGACATTTGTTCGTAAAAGTAATTTAATTTTCTCTGAAAGCACCGAGGAATGCCTCTATCCCTCTACTTTGCT
TCACATTGATTCGCGTAAGGCTGCTACTTGTGCTTGGAACTCTTCAAATTCGCCTTGGAACTTTGCTCTTTTCTTCTGCCAGAGTCTGAGGGTGCCATCG
GAGATATCCGGCTGAGATGAAAATGTCGTGAATAGCTCATCCACTTGAGCGGAGAAGTGTTGCAGGTGTGTATGGAGGTCATCGGCTTCGATAGGGGGAT
ATAGCGCCGCACTAACGTCAATCACTATGTTTCTACTCTGCGTATACTGGCGATCGAGAAGTGAGGTCCATATAATCAGCTCTGCATTGTCGCCAGAAGC
TGAGTTCAGTGCGTTAGACACCCTTGTGAGGACTAATGCTCCGCCCTTTAAGATCGCACCAAACATCTCGAGGATGCGTACACCCAGAATCACTGCCGAA
CGATCCTCGGACGATACCGTTGCGTCGAAATCAAAGTCGTCCTCCAGCTCTACCAAGTCGAGATCGGTCTCCTTTGTTGCTTCCAGGCATTCCTTCAGTT
CTTTTATCGAATCCCCAAGCATACTAAGAGTCTGAAAGAAATTGAATGAGCTAAAGTATGCTTATATGCAGTCGATCACCCGTACCTCAAGCGTATTGCG
CTGGAAGGAGGCGTGATTAGATGTCGGGATTTCCTCTACTGATTTACAAGAATCCCATATTCGTCCTGTTAATTCTGGAACGCGCCGCATTTCTTCCTTT
TGAAGCGCTGTTGTTAATTCCCGCAGGCTGTGAAAGATTCGTCTGCAGATTCCGTGGGCGTTGTTACTTTCAGGTAAATTATTTCAGTGGATATCGTGAA
CATACATTGAGCTTTGGACGATACTTGCTGCAAGAGAGGGTCCAACACCGCAGAACAAAGCTGTTTTGACTGCGGAGAAAAACTGTTCGCACGGTTTGCG
CAGGCTTTTGCACATACTTTGGGCTTCCTCGACGGAAGGATTCTTTGTATGTACCATAGAGAACTTTGTGATCTCGTGGGAGATGGATCCTGCTGCCTGA
TAACAACGCATTCGATACCAATTTTCACCCTTTAGTTGCATGCACTTACCGCGATCAATACTTGCCTAGTGATGGTGAAACTTTCAGTGGTATCCCAAAA
GGTAGCATTGAAATGTTTACTATTGCCATGGAGCTTTAGTTGCTTTAGATACACCGCTATATTGGCGTCAAATGCAGCAATTATTTCCTTCCATGAATCA
TTACTTCCAGTCATATGTACGCGGA