Description :
From Genome Similarity Track
Location :
Scaffold_399:24014- 25332
Sequence
1318 bases(100 bases per row)
TAGTCTGTGGACGCCTCCAACCCGTCAGCAACGCACGACCCTACCGAGCAATTCGACGAGCACTGCACAAGGACTTCAACCAATATTCCGCAAGGCTTCG
ATGCTGTGTCTTGACAGTATGATGCCTCGTCGGTGCCAGTCGATACTTCGCACAGACTCGTCAAAGCGTAGAACTCAAGATGCTGGGGCAACGACGATGA
GTAATTTGCAGCGTGCGAACAAGTGGAGCATCCCGTCGATTTGTCGTAACAGCCCGCCAGCGATCGGCGCATCATTCGATACGCAACTGCGTCTCTCGGG
ACTCCGCCCGTGTCATTGGTCGCCGTGAACGATACATTGATCGACCCGCCAGACACGTTGGCCACGCCAATTGAGATCGGAGGAGACGGCAACCCCGGAG
CCAAAGTTGTCGCAGAAACGGCAGTCTCGTCGACTGTGCCAGTTATGTTGTACTGGTTCCGCGCAACAACGGAGAACACGTAGGTGTGCTCAGCAAGAAG
ACGGATCGCAGTGAAATTCGATTGGTTTCGATCGTCAATGTCAGCGACAATCTTGGCATCCTCAGCTGTGGTGATATCGCGCTGATACACGACATACCCT
GCAAGAAAAACGAGGAGCTGTTAGCTTGTCCAACTCGCGCTTTTATAATACCTTTGGCTTATCCTTACCAGCGACTTGACCGCATCCTGTCTGTTCAGGC
GGCTCCCACTGGAGGAGCACTGAACTCCACCCGACATCTGATATGCTCAACGACTTTACCTTGGACGGAGTACCCGCGTTGCCAGATCTGAAGGTGTATT
CTGGGCTGGATTTCGAAAGGTTAAGATCGTTCACTGTTTGAGCAACAACAGCGAACTCGGTGTTTGCCTCCAGATTATAGATCATAGCGATGTCTGACTC
GTTTCCGATAAGAAACTGCGAGACTATCACGCCTTTCGCATCGGTAACTTGGCCAGAGTATCCAAGAATTGCGGCACCACAGAAATCATTCGGCGGTGAG
AGCACGACCATCACCGTGCATCCGCTCAACAGTCGAAGGCTGGATATTGATGGAGGATCTGGCACCGACGCCTTGTCGGTTTCCACCGAGAGAGCTTCAC
TCAACAGTTCAATATCCACTGCGTCGTCACATACCACGCCTGGCTGTAGCGCAAGAGCTTTGAACACGTAGCTCGTCTGCGACGTCAGGTGAGTGCCGTC
CCAGTCCTGGACAATTGTTGCTATCACAGACCCCTCAGTGGCCTTCACAGTCTTCAGTCTGACAAACGAATCGTTGTGCGCGATGAACACGTCGAAACTG
GTCACCAACAAGCCACCT