Description :
From Genome Similarity Track
Location :
Scaffold_137:240098- 242180
Sequence
2082 bases(100 bases per row)
TACTTATAAATACATCAGTCTTAAATCTACTCCTCTAAGTAGCAAACCGTTCCCACTGAGGCCGGGAACACGTGGACTTACGTTCACTCGGGTAGTTAAT
ACCCTTAAGCACTTCCTCTGTGCAAGGTGCTGTGTGACCCCGTCACACTTGGTAGCACTAGTAGTCAATCCAACACCATCGCGGGTAGATTGAACTACCT
GAATCCTCTGTGCGCTCAACGTTTGAGCCAAGATGGACCGAAGCGAGTTTCCTCGCTTGAACGACTCACAGTACGAGTCTGTTCGGAAGATGGGAGGCAT
CTTTGGACAAGATGTCCTTCGCAGCTTGGCGGCGGCGACGCCTGCCGAGCAACAAGAACGCGTGACCGCGTTTGAGACCTACGAGCGTGGTCTCATCGCT
CACGTCCGCGGGGGCTTGGAGGCCACGATGGCCGCTCCCCAGGCAACCAGGCCTAAGCCGGTGTGGCTGAAGGTCCCCGCGTCTGAGGGGAAGGAAGGAG
AGAACCTTCACTTCTGGGTCCGTGAGGTGGAGATCGCCATGAAGGCGGGTCTCATCTCGGACGAGCCAGTTCGGGTGGCGTCTTCCCTGTCCAACCTTGG
TGGACGTGCCAAGCACTGGGCATACACCAGGGAGACGACATCTCCTGGATGCTTTGCATCCTGGGCTCAGCTGTGTGAGCAGCTTCGAGCCGCGTTCCTA
CCGGCGAACGACGAGTTCCGCCAGCGCTCACGCTTTCTCGCGTGTAAGCAAGGTAAACGTGAGCTGCAGGAGTACGCGCAAGAGATGCGCACGTTGGTGG
CATCTCTGGCAGGGAATCCTCTGCCTGAAGACATTAAGCCAACAGTCTTCATGGACGGCCTGAAGGTCGGTCCTGCTCGCACCCAGCTATTCCGGGTGCA
AGCGACAACTATGGAGGAGGCGATTCGAATCGCCCTCCAAGAAGAGTACAGCCACAAGCAGGCTGGTACTCTTCGGGAAGAAGAACATCGCCACGATGAG
AATGGCGTTCCTCGGGAGGCGGAGCATCGCAGCAATGACGCTGTTGCTCCTGCTGTCACGCAGCCCGTCGATACCGGTGCGTACAGCGAGCCCGAGCCCA
TGGACTTAAGCTCAGCCGAGAGCTTGGTCCGCTGCTATGGATGCGGCGGACATGGACACTACCAGCGTGTGTGTCCCTCGCTAGTCCTCGGGAAGAAGAC
GGCCCGTGGGCCCCAAGTCCGGTGGCGCAGGCCACGGCCAGGTGGACGAAGACTCCCCGGCCACCAGTAGAGGCGGTATGCCCTACTGAAAAGCGCTAAG
TCTTTGTGATGGGTGTGCAGGTTGTGCACACCACGGGACTTAGCCCAGAGAGACGTGGTTCTCTCAAACCGGTGAAGGGCAGTGATGGGCTGCTGGTAGT
ACACTCGGTGTACGGGGGTACGGTACCCCTTGAACGTTTGATGAGTTCTGGGGCGTTGATACGCCGCCGGAACGTCGCTTGGCATAGCGACATCCGACTG
CACTCTATGTCAGAGTGGCGGTCATGGGCTGGTCCTTGATGGACTAGCCTTTGGTACGGTAGTATCAATGGTCCTCAACGGACCTGAACGTTTCGGCTCG
ATGAGCTCGCGCACCGCGGTGTCGCTCGCAGTTCTCGCCATGAACAACATGGCTGTGCCGAACATAAGACACAGCCCGGACTTTGGTGTGGCAAGGCTGA
GAAGGGCCTACCAGTCCAGGTCTATGACGGAGCATTGGTGAGTCATGTTCCCACCTCCGTCATGACTGGGGCGTCTGATACAGACCGCCAGGACGCAGAA
GCGTCACGGAGTTGTCAACGCGCCGACAGCTCTGCGTACAGCAAGACCATGCTCCGCTGCGGCAATGCCACGGGCATGGGTCTTTTGCCCGGCGTGTGGA
CCTGCTACACCAGCAGCGTCCAACGCCGAAGGTCGTCGCGCCGTACGGGCTTCGACAGTGGTTATGCCTTTAAGCGCTAACCAGGTGGGTAACTTAGGAC
CACACGGTCGCCCAGACCTTAACTGAAGAGGAAGGCGCTGAATGCGCTTCCTGTGTGGATAACACAGTACCACACGCAGTCG