Description :
From Genome Similarity Track
Location :
contig_48:24009- 25473
Transcript NameFunction/comments
g9787.t1XP_009518107.1 hypothetical protein PHYSODRAFT_481033 [Phytophthora sojae
g9788.t1XP_009518106.1 hypothetical protein PHYSODRAFT_349597 [Phytophthora sojae

Sequence
1464 bases(100 bases per row)
TTCGTAGCTGCCATGACTTCATCCCGCAAGTTCTTGACCACCACTTCCTGCGATCGGTGCATTGCTCGCCAGACTTCACCAGAGGCGCCAGCAGCCAGCT
TCTCTTCCTTGACAATTACATCAAAGTCGATACAATGCGAGAGCAGCTCTTCGTCTTCCCAAATGGACGAAATACTGGGCAAGTCTGACAATGACATCTC
CTCCCCCTGCAGCTCTGCATCTTCCTGTTGGTGAGCCTGTGAAAGTTCCGTCTCCGCCCGTTCCTCTGTTATCCCCGGTGTCGGTCTGTACGTGGCAGTG
ATCCTCATCTGGGGTCCATACTCCTGGTCGAATTGAATCGACGGTGCCGATCTCGGCGCCTCGCGGTCTCTTCCTTCCTCGGTGTCTCTCTTCCCCACCA
CGAGCTTCCCTCTGCTCCTGCTTCTCGACCGCGAGGCCGAAAACAACCCACTAGCGCTGCGGAAGCTGCTACCCGGCAGGGAATGGCGTCGCTTGTTCTT
GGCAGCGTCTTCAAACACAAAGTCCGGGTCGTTCTCCACCGCCTCTGCGTCCGCTCTGCGCAGTGCGTAGCTCTTCATGTGGTACTTGAAGCAGTGCGTC
CAGACGCTGCAGGCCTTGGCCGACACGGCCTTGAAGCGCTCTTCCTCGGGCATGTAGAACCGCTGACTGTCTCCAGGCAGCAGCAAGCTGCTCACGCGCC
GGGCCATCGAGTCCGACGCCTCCTTGTGGAGCTCCTTGTCCTGCAGGTATCCCAGAGCCACGAAGCTGCGGTCCGCGCGACTCGTGAGCGTCACGTGCGT
GAGCACCAGGCGGCGCAGCAATTTGCCGTTCACTGTGTCGTCGTCCGAGAACACAAACAACGCCGCCTGCTGCGCCTTGAACACGCAGAAGCGGCGGCGG
TAGCGGCGGAAGATCCCGCGCCCTTCGCGACGCCACAGCCAGCCGCTGAGCCGCACGGGCAGCGCCAGCGCGCGCTCCGGAGCCTGCACCGCCGGGTGTT
GCTCCTCTAGGTACTCGTAGATGCCCTGCTCGGCGTCGCGCACGCTGCGCACGGCCACGGCCGCGCCGATGGTGACGTTGTCTGCCATCAACTCTCGAGT
ATAAGGCCCAGTTGCGAGTGACACCAGTGGTACTCTTTCGGGGGTATTAGTGGCACTCTTTCGGGGATCCTTGGTTCTGGGATATGCCGGGGTCGAGGCT
AGAATCCAGACGCCTCGCACACGTAGGGGAACCGAGTAGAACGCAGTTTGCCTGCCGCCATGGTGCTGTCGGCTGTCTTCATCACCGACCTCAAGGGCAA
GGTCATCATCTCGCGCAACTACCGCGGGGACATCCCCATGTCGGCATCGGCCAAGTTCACGCGCTACGTGCAGGACAGGGACGACTCGGAGCAGCGCCCA
GTCTTCACGGAGGACGGCTACACATTCGTGTATCTCAAGGCATGGGGACTATAATTTGGTCCCG