Description :
From Genome Similarity Track
Location :
Scaffold_22:240067- 242593
Transcript NameFunction/comments
Physo_132716hypothetical protein

Sequence
2526 bases(100 bases per row)
GAGACCAGTGTGAGGGGTAATACCCTTGCAATCTTAAATCGGTCGGATTGATGTAGCTCGAAAAGTTCGCCTTGCTTAGCAACTTGCCACTACCCACGCA
GTGGCAACAACCTATTGTGGAATAGATAGCGATAATAGGTGCTTCGTGCTAGACGAAACTCTTGAATCTAGGTGACTAGCCGAGCGCCGCCGCTTTGCGG
CGGTAAATATAGGTTAAAACTATTGGGTGTGCAAGCACCCCCGTTCCGCTCGCCTCGTCGGCTCGCTGCACTACTCGCCGTGCTAGGTTAGTTATGTAGG
ATAGGCGGGCCCTGTTGGGGGTCCGCAACGCTCAATAAGGTTTTCGGGGCTGCCTTCGCTATGCTCGGCAGCTGATCGGAATCAGTGGGTTTCGTACTTA
GTGAATAAGCGTGATCTACGCTCGGACACGACCTACTGTATTGAGTTTTCAGTGAAGCCAAGCAACTCAGTAAAAGTATTGACGATGATGGGGCCACAAC
CCAATACAGAGATGAACGAGGCTGCAAAGGCCAAATGAAAAACAGAGCAGAGACTGGATATGATGTATATCACTATTAAGTAGAACGGTAGTGATCTTAC
GTATGACGCCTTATCAAGTGTCTAAGGCAGTACAGATACAGCAATGAGATGTCTCTGCGGAGACTCTTCGGTGACAGTCGATCTTCGTTCTTTTGTTCAC
CGGTGTTTCGGACGATGAAAAAGAAGCACTGACAAAGACGACGAAAGTGCGGGGGCGAAAAATATAGGACATTTGCCCTGGTGAGCGTCTGGAAATATCA
GAAATATTATCACTGCTAGCGGCAACATTTTGGTGTTGAAGACGTTGCTGGACCAACCAGACCGTTTAGTTCACCCCCTCCCTTATGCACAGTTGCAGAG
CTAACTGAGCCTCCTTCCCTTCAGACGGAAGGGAAGCACAAGTTGTGTCGCTTCAAGAAGCGGATGAGCCAGCCCATAGACAGTGTCAGCGTCATAGCGG
GCCCACCCACCTTCGTTTGTATCTCACGCGCTTTCTTCTTTAGTGGTGGTGTGGTGTGTGTACGGGGGGGGCTGGACAAGCTTTAACTGTCCCCCTTAGT
ATATGCAGCTAAATCTTCTTGTGTGATCGTTGGGTCTTCTCCATACTTCTGTATCAGCTCACGTTTTCCCTGATTGTCAGCGAACGTGCCATACTCCCCA
TAGCTGACCATTCAAAGGTGAAAGGTTTTCTGAAACATTATAAATATATAATATAAGCGCATAATGTCTCAGGAGTAATAGGGAGTCCTAGATGTCGGTA
GTGAGGGTACACACCGTATTCTTGTCTACGGTCGACGCGGCTGTGACGCTGTAGCGTCGTTACCCTCGAAATCCGATGACTGCAGCTGTAACCCCACCCC
CATCTAAATCCCTGCTCTCGACTGACGCCTCCCTCCGTCATTAAGCGAAAAAAAAATTAAGTTTAACCTGATAGCAGATGCGGGGGGGGGGGTCATGCCT
CTTCCAACTTTTTTATTTCAGGAAATTACAACGCGTTGAAGTTGAAAGGCTATTTTGGTGATAAAACATCAAATTTTGCTAGGTTTGGTTTTACTAGGTC
ATTCCTGAAAGCAATCATTTCTTCTCGCAACTGCACTAAAAGGGTTTGTTAAAGATACTGGGGAGTTTCCACGTGGAATTCGACCATCCTGGAGGCCATG
AGACGCCTTTAAATAACTTCTCGATAGTGTCTGCTTCCACGTATCGCGGATAGTTTCGTATTTTATAATCTTTACAGAAAGTCTCAACTATACAAACTCT
AACTACGACTTCCCAACCCGGACAATACTGGAGCGGATGGTAGAATCATAAGCGTCATTTATTTGTGCAACAAACCTAACTCTCCTTACGTCTGATACAA
TCCGCTGACGCGGGCGAGCTACTCCGCCTTGGCTTCTTCGTCCTTGGACTCGTCATCGGTGAGCTCCACGCGCTCCATGTGTTCCTCGAGGTCGCGAGCA
ACCAGTTCGTCGAGGCAGTCCTGCGTCCATAAGTTGCGACGAGCGAGCGTCAACAGACGAGCCTCGTCCGCGGTGATGAAGGCCCACGCGGACGCTGGGT
TGTTGTTGTCGCCTTGCATGAAGCACCAGGCGGGGCCGAAGCAGGCCTTGACAGCACGCGGGCTGCTTGGATGGTTGCCTGCGCATGGCTGCGTTGGGAG
GCGGGCGAGGTTCGTGAACAGCTCCACGTCGGGTAGCGGCATCTTCGAGGAGGATCTTGGAATGCTGTGAGTTTCAGAAAATCCTCTGAAATTCAGAGCC
GGGATTCGTACTTAGGCTGTGAATTTCAGAGACCTTTCGCGAATAGGTGCGATCCCAGTGGTCGCGCGATCTTATCATATCTTCCGAGTCGGTCGATCGG
ATTTGCAGGGATAAAAAAATTCAACGACAGTCGGTCTAACTACCGAAATCGCAATTAGACTGTGAGTGTGGAAAACGCAAAAGTGGAGATATGGCACATC
TTAAAAGTCTACTTTTGAATACAGAG