Description :
From Genome Similarity Track
Location :
Scaffold_16:240007- 241416
Sequence
1409 bases(100 bases per row)
GAAGACATCGCAGATGCTTACTCGCGACCTTGAAGCCGTCCACGCGACCTTGCGCGAAGAGATGGACAAGCTGGTGGTCGACCAAGCCACTCTGCTTCAG
AAGCTCGCGAGCGGCTTGTGGAAGTTGTCAGCTTGGGAGAAAATCGGGATCAATCGCGCGAACGCCTAGCAGGCATTGTATCCTTGCTTCCTTCCGGGTC
TGCTTCCACATTGTCCCCATCTCCTCAAATCAGCAAGCGCCCTCGGGCTTCGGGATCTCCGGCTAGAGCTACTCGATCGTGTAAAGTTGTGCGATCCTCG
TATGACTCGGTTTCTCCGGGGTTCACGTCGCAACGCCAGCCATCGGCGAATCCGATCGACATGTTGTCTACTGCTGCTGCAACCCAAGATGCCGCCTCGG
CGCCTTCTGCTTCCTAGGATAGCGGCAAAGATAATTTCCAACAGCTTCTTCTCGATCCCGATCTGCTCGTCGGACGTCTCGCGCCACATCTGATTCTCCG
CAGCTTGCCCGTTTGACTCGGTCTTCATGTCAATCCGTGGGTGGCGGCCATTCTGACAGTATTTCGTCCCACCTTGCTGCAGCTGGGCTGGGTTCCAGCA
GCGACAGCAGCAGTTCCCGCGGCTCATAACTTACCACCAGCGGCTCCGACACAGATTCTGGAAGTGACGCATCTTTCGAGTCTCCCGATCGTGGTCCCGG
TTTTGTTGGCTTGCCCAATGTCTTGCTTTCGGATACGGAGTTGGCTGCCCTGCCGGACACTCGTGTACCTCAGACCGACTGGATCCCTGGCTATCGCGAC
CACCGCCTCTTCCAGGGTTATGCTATCGTCCCCTGGTCCTCGATAGACGTACACCAGACGTGTATCGCGGAGATGGGCGTGGACATCCTGCTCAATCAAT
TTTCCAAACCTCTGTAGTGGTTGTTCCCACTTCGTTGTCCGACACCCCAGCTCCAGGGGTGGAGAGACGATCTGGTTAGCGAGGATGGCGTGCACGCCCT
GATTGAGTCGGCTTCATGGGAGGTGCTCGTGTCCGGCGCCAGTCCTCTCATGTTTGGTGAGAGCGAGTGGTTTGTGCATATAGCACATCTCTACTCCACC
TACGAAGCGGAGTACCTCAGGGCTTACTGGGATTCTACTCATGCCTTCCCGGTCAGCATCGCTAAGCGTCTGCGCTAGTCGGTACCTGGACGCCTTGTAA
GCCGGCCGTAAACAGCGGTAATCCCGGGCAGGGGCCCGGTGGAAATCTTTTCTCCGGCAGATACTGCTGGGTATGATTCGTGGCTTTTGTGACCTCGATC
TACTTTTAGATCCGTATTTCCTCCATTTTCCTCGCAAAGGTGAAGCAGGAGCTTGGTATCCAGGAATTGAAGACGGAACTAACCCGGACGATCTTCTTGA
AGCTTGGCT