Description :
From Genome Similarity Track
Location :
Scaffold_93:2400- 7663
Sequence
5263 bases(100 bases per row)
ATGTCTGTGGTGACCTGTCATTGTTTACTACCATAAGAGAAGACCAAGCTAGTCGACTTGACTTTGCGAATGGCACAACTGAACACACTTCTGTTTGTGG
GTCTGTGCTATTGCGTGTTGTTAACCAGGCAACTGGCCAGCTCGAAGACCGTCTCCTGGACGACGTGGTGTACACACCGAACGCGAAGGTGAATATCATT
AGTTTGGGCTACCTACAAACGAAGGGCAACTTCAAGTTGACATGCTCAGAGGACCAACAGACTGCTTGGATCTCCAAGCCAAGCACATCACTCAAGTTCA
TGATGCGTGACAGTATCTACCGACTACGTGCAGAAAGAGTGACTGGAGTAATGGTGATGGCGGCTCTAAAAGAGGACATGGACAGCAAGAAAGCCATGGA
GCTGCTTCACCAACGATTTGGTCATATGAGCATGGAGACGGTGAAAGTGTTGGCAAACAAACTCGATGTTGGAGTTAAGATGAATGCAAAAGGTCTGACT
TCCTACGAGTGAGTTGCGTGTGCTGCCAGTACGGCGAAAAGAATGTCTTATAAACGGATTCCATCGCGGAAGTCCGAACCTCTGGAGACTCTCATGATGG
ATATTTGCTCTGTAATCGAACAGTCTGTGGATGGAGCTACAATGTTTCTCTTTATCATCGATGAGTCTACAAGGTACAAGTGGCCGTTCCTACTCAAGAA
GAAGAGTGAAGCAACGTTCCACATCAAGGTCCTGCTGAACAGGCTGCGAGCTCGCTTTCCTGAGAAGAAGGTGCGACGACTACACTCTGACCAAGGAGGT
GAATTTGAAAGCAAGGAACTAAGTGACTACTGCGTCGACCAAGGGATTGAGCAGCAGTTTACGAACGCCTATTCTCCTCAAGAGAACGGCATTGTGGAGC
GTGCTAATGGCATGGTTCTACCAAGGATCAGAGCGATGCTGATGGCTACACACATGCCCAACTTCTTGTGGGGAGAAGCCTTCCTGCATGTGGTGACGAC
GTTGAACTGGTTGCCCACCAAGCCCTTAGGATTGGTGTCCCCGCACCAGAAACTGTACGAATCGGAGCCCATGCTGGATGATTTGCGTACTTGGGGCTGT
CTGGCACACGTGCGTGTTCCCCCTGAGTCAAGACAAGCGAAAGAAAAGCTGGAAGCAAGGGCAAGACTGTGTTTATTACTGGGTTATAGCGAATCGACCG
TAGGCTATAAGTTCATTGACCTGGTGACAGCTCAAGTGGTGACAGCTCGTAGTGGGAATGTGAAGTTCCATGAAGAGTTCACAACCGATGGCATCTACAT
GAAGCTTCTATTAGAGAACGCATTCTTTGATGGTGATCATACTCTACGCGAGACTGTACCTGTGGCGCGCATCAAGACCAACATGGAGACGTACCTTCCA
GGTTGGAGTGACGGCATCTCTAGTGCAGAGAAGCCACTTGAGGCGGTACCACTTGCTGACGAACTTGCAGAAACTGAGTTAAGTTCAAGTGGGAGTTTGT
CAATCGTTGACGCACCTGTGAGCAAGGACAGTGCGGAGACTGCTCGTGTTGCAGCACCAGCCGTGTTGCAGGACCCTGCTGAAGAAACCGAGGAAGGTTT
GGAAGTGAGGAAGCGCAAGAGACGCAGAACAAAGAAGAAACCTGCAATGGTGGAGAAGGAGACAAGTGGCTTCGAGATTCAACCTCCATCAAGAGACCCC
TGCCTAAAGCGACCAAGAAGGAAGCAGAAGGCGAACGTTCGATTGTCGGATTACGTGGTAGGCCTAGTGCAGGCTATGACTACGGATGTGCAGATTCCGA
CGACGTACAAACAAGCACGTGCAAGCAAGTAATGGCAGCAGTGGAGAGCTGCAATGTTGGTGGAACTTCAATCGTTGAAGGGTCACAAGACCTGGAAACT
TGTACCCCGCAAAGATGCCAAGAAAGTGAAGGTGATAACGTGTAGGTGGGTCTTTGCTGTGAAGCGAGATGAGCGTGGACGAATCAAACGATTCAAGGCG
CGACTAGTGATCCATGGATTCAAACAACAATTTGGGATTAGCTACTCTGAGACCTATGCACCTGTGATCCGGTTCGAAACCATACGTGCGGCTATCTACT
ACGCTGTACAAAGAGGTTGGGAGGTGTTGCAATTTGACGTGAAGACGGCTTTTCTGTATGGAGACTTGGATGAGACTATCTTCATGGAGCAGCCTCCTGG
CTTCCAGGTGGATGGACCTGGGTCCATTTGCAGATTGTTGAAGAGCCTGTACGGACTAAAGCAAGCACCGAACGTTTGGAATCGCACGCTTCATGCGAAG
CTTGTTGCGATGGGGTTTACTAGGACGGACTCTGACTACGGCCTATATGCATTGAGGAAGGATGGTGAAGTCAAGTTGCTATTGACTGTTTACGTGGACG
ATCTACTGCTGATGGGTTCACGTGACCTGTGTGCCACAATCGCTGCCTCACTGCAAGAGACATTCGAGCTCACGACGATGGGCACAGTCAAATATCTCTT
GGGTGTCGAGATCCTGATTGACCGGCCGCGCCGGCAAATAGTATACTGCCAGAAGCAGTACGTACTGGAGGTGTTGAAGCGCTTTCATATGGAGAACTGT
AATGGCTGCGCTACACCAGAAGCCACGACGCCCTCGAAGACAGACGTGCCTGCTTCGAAGGAGTATCTTCCCTACAGAAAACTGGTGGGTGCTCTCCGGT
ACCTCGTTAGTGCATCGAGACCTGACATAGATCATGCTACCCGACACCTGGGCAAGTATCTTGCGAGCTATGATCATATGCATTTCGCACAAGCCAAGAG
GGTGCTGCGTTACCTGAAGGCTACATCTGACTACGGACTAGTGATGAATGTGGAGCTACAGACTGATGTGCAAGTTAGTGGCTACTCTGATGCTGATTAT
GCGAACGACCCTGTGGATCGACGGACTATCAGTGAATACATCACTATGCTGGACGACAACGTCATCTCCTACGCATCCCGCAAGCAAGAGATCAACGCGC
TCAGTACCTGTGAAGCTGAGTACGTAGCAATGGCAGAGGCGACCAAGGACTTGTTGTGGCTTGCTGGCCTATGCAAAGAGTTGAGCTGGAAGCATCCAGT
ACCTCAACTACTGGGAGACAATCAAGGAGCCATTGCCTTAACTGCGAAACCTGGCAAACATTCGAAATCGAAACATATCGATAACAAGTACCACATGATC
AGACGCCATGTGGAGTTGAAGCAGCTTACAACCCAACACATCGGAACTGATGATATGGTGGCAGATATAATGACAAAGGCACTTGCAGAGGTGATGTTCA
CACACTTTCGCAAGGCTATGAAAGTCTTACCTATTGTGTCGAGCGACGACAGCGTATCCGAGGACATGGCTACAACTACGACTACTGCTACTGCGTTGAC
TACTGCTGTTGATGCGGAGGCTGTACCTGAGCGACATTGATGAAAACGAGGGCGATCGAGTGGGAGTGCTGTTACTGAGTGGACTGCTATTGTCTTTGAG
CTGCGACTACGCTACTACTAGGACTATGGCGGCAACTAGGATGCGCGTGTGTGATCGCGTCGACTTCCAAGTGCGTCGCCGAGATCAAGTGGGAGTGTGA
GCTATAAAACTTACCTGCGTGTCGAGCGCCAGTGCATTGCAGTCTGCCAGTGTCCGGTGCCCCCATCTACGAGCCACCGTCCACTGCCAGTGTCTGCAAA
GACACATCCCATGGACACTCATGCGCCTGGCAGTGCAGCTTGCGGCTGTACTACAACCGGCTACACTGAGTACACATGCGTGCAATGGCGAAGGACTATA
CCAAGGACTGTATGCACAAGGACATCGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN