Description :
From Genome Similarity Track
Location :
Scaffold_1760:240- 1660
Sequence
1420 bases(100 bases per row)
TGCGGTACCCGCTGAAGTGACTGCGGAGCAGACGGCGCGTCTGTTCGTTGACATGGTGTTCAAAAACCATGGCATGCCGATCGACATTGTGTCGGATCGA
GACCCGCGCTTCACTGCACACCTTTGGCAAGAAGTGTTTACACTTCTTGGGAGTCAACTTTCGATGTCGACTGCGGATCATCGGCAGACGGACGGGCAGA
CCGAGCGCGTGAACCGCGTGCTCGTAGACGTGCTTAAGAGCTACGCTCACTCGTTCCAACACTGGAGCGAGTGCCTGCCGATGGCAGAGTTCGCCATCAA
CAACTCGGTGCATGCCTCGACCGGGCATACACCGTTCTACGTGAATGCCATCAGGCACCCACGCCTCCCGAGTCTACTCGGGATGGTGGCTCCTTCCTTA
AGTGGGGGAGGATCTACGACTGCACAGCAGTCGCAGAATGCCGCTGACACTTGCACAGTGTCAGCCGCGACTACGCGCAACAAGAAGAAGAAGCACGCGT
CTGTGCAGGGCACAGACGTCGACAAGAGCAAGAAGAAGAAGAAGAACGGGTCTGTGCACCGCGAAGACGAACGCAGAGGCAGGGCCTACTGCTAGAAACG
AGCTGAACGAGTTCAGCTCGGACGCAATCAACTTCGTGCAGCACAGACAAGCCGTCATTCGGTTTGTCCAAGACGCTATCGCAGCTTCTGTCGACCGACA
GAAGCTGAACGCAGACAATGTTGGTAGGGGCAACACTAATGAATTCAAGAAGGGTTCATTGGTTTTGTTAGCAACTCAAAACCTGCCTAAACATGCAGTT
TCCGACTTCGGGGCGAGCAAGCTCGCTCCGCGCTTCATCGGGCCGTTCACGGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNN