Description :
From Genome Similarity Track
Location :
Scaffold_86:24- 9714
Transcript NameFunction/comments
g7081.t1hypothetical protein

Sequence
9690 bases(100 bases per row)
CACACGTAGTCTGGACAATCGACATCGGTATATCCCTCCGGCTGAACAAGTTTGTGAGGAAGAAAGCAATGTTCATTTGGGCGACGGTATTGTGAGAATT
CTGCTACGAGAACGGGAACAACTGCTACGGGGCATCTTTGTCTAGTCTGTAGTTTGGAGTGCTCTGAAGTACGCACACGTACCTACTGCGAAGTTCCCAT
GCATCACTGTTGCTCACAGGTCTTATGAACTCCGTGACGCTGATGATCAAGCCGTTGAAGATTTTGGCGACTGCTGCTACTGCAGCTTGAGATGCTATCA
AAAAGCAGCTGCGATTCCAGATACGGTGATAGGCACGTCACTGTCAACAACGTCCTCAGAAATTCGGCTTGGTAGTACAGCAATGACCCACAATTGTAGA
TCCCTACCGGGGGCGATGGAAGAAGACAGCGCTTCAGTTGTCACACGTACTGCGAGCAATGTACAGCACAAACCAATGCAACCAAACGCCAAACCGGGCG
CTAAATCTGTGACCCCCAAAACACAGGCTTCTTCAAAGAGGAAACGCATTGTATCCTCATGTACGAATACTGGAAAGATAACGAAACAAAAGAAAACAGA
CAAGTCTAAAGCAGAATCATCGCCGCGGAAGAAGGCAGCCCATTCGGAAAAAGAAATCGCTTTTAGAGACGAGCTCTATCATAGAACACGATTATCAGCC
AAAACGTTCCTCAATGCATGCGTATCGTTTACTCCAACAGAGGAATCTTGGATGCCTGCGAAACTCGTGACGTTGGTGCAGAGTATCTAATTGGCGTTAT
AACCCGGTTTACCTTTTCAGATGATGAAACTGCTGACAATATTTGTGTACAAACGCCATTGTATAAACTACAGTGAACAAATATTACAGCTGGCTGATGT
CACTGCCGCCGTCGCCACCACGCCCGACCTCGTCCAGCGGCCTGTGCCACCAAACACGCTGCCGGCCGAACGAATACGCCAGCCCATCGCCAACCCATCG
CCAACCATCGTCAACGGTCGCCAACGGTCGCATCTGCATGTGCACAACGAGGTACACGCCCGCCACCTTCGAAGCCGCGCGGCACGCCGGCCGCTGGCCG
ATGTCACTGCCGCCGTCGCCACCACGCCCGACCTCGTCCAGCGGCCTGTGCCACCAAACACGCTGCCGGCCGAACGAATACGCCAGCCCATCGCCAACCC
ATCGCCAACGGTCGCCAACGGTCGCCAACGGTCGCCAACGGTCGCATCTGCATGTGCACAACGAGGTACACGCCCGCCACCTTCGAAGCCGCGCGGCAAC
GCCGGCCGCTGGCGTGTCCTGCCGCTCGCCACCCACGCCGACTCGTCAGCGGCCTGTGCCACCAAACACGCTGCCGGCCGAACGAATACTTCCAGCCCAT
CCAACCATCCGCCAACGTTCGCCAACGGTCGTCAAGCCATAGCCAACGGGCGCATCTGCATGTGCACACGAGGTACACGCCCGCACCTTCGACCGCGCGG
CACGCGGCCGCCTGGCCGATAGTCACTGACCGCGTCGCACCACGCCCCGACCTCAGTCCAGCGGCCTGGTTGCACCAAACACGCTGCGCCCGAACGAATA
ACCGCCAGCCATCGCCCCAACGCGTCGCCAACGGTTCGCGCAACGGTCGCCAAAAAGGTCGCCAACGGTCCGCAACGCGTCGCCAACGCGTCGCATCTGC
ATTGCACAACGAGGTACACGCCCGCCACCTTCGAAGCGCGGCGGCACGGCCGGCCGCTCGCGATGTCACTTCGGCCGTCTCACCACGCCGGACTCCGTCC
AGGCGGCCTGCTGCCACCAACACACGCTGCCGGTCGAACACGACTACGCACAGCCATCGCAGAACCATCGCCAACGGTCGCCAAACGGTCGCCAACGGTC
GAACGGTTCGCATCTGCATGTTGCACAACGACGGTACACGCCCGCACCTTCGAAGCGCGCGGGCACGCGGGCCGGCTGGCCCATGTCACTGCCGCCGTCG
CCACCACGCCCGACCTACGTCCAGCGGCCTGTGCACCAAACACCGCTGCCGGTCCGAACGAATACGCACAGCCCATCGCCAACGGCTTCCGCCAACCCAT
CGCCAAGCGGTCCCAAACGGTCGCAACGGTCGCTCTTGCAATGTGCACAACGAGGTACACGCCCGCCACCTTTCGAAGCCGCGCCGAGCACGCCGGGCGC
TGGCGATGTCACTGGCGCCGTCGCCACCAACGCCGACCCTCGTTCAGCGGCCTGTTCACAAAACACGCTGCGCCTGAACGAATACGCGCCAGCCATCGCC
CAACGGTCGCCACGGTCGCTCAACGGTCGCCAAACGGTCGCCCAACAGGTCGCGATCTGCATGTGCACAACGAGGTACACGCCCGCCACCTTCGAAAGCC
GGCGCGGCACGCCGGCCGCTGTGGCCGATGTCACCTGCCGCCGTCGCACCACGCACCGACCTCGTCCAGGGCTGTGCACAAACACCGCTGCCGGCGAACG
AATACGCCAGCCCATTCGCCAACCCATCGCCAACGGTCGCCAACGGTCGCCAACGGTCGCCAACGGTCGCATCTGCATGTGCACAACGAGGTACACGCCC
GCCACCTTCGAAGGCGCGCGGCACGCCGGCCGCTGGCCGATGTCACTACCGCCGTCGCCACCACGCGCCGACCTCGTTCCATGCGGCCTGTAGCCACCAA
ACACGCTGGCCGGCCGAACGAATCGCCAGCCCATCCCAACGTCGCAATAGGTCGCCAACGGTCGCATCTGCTGTGCCACCAACGACGGTACAACGCCCGC
CACCTTCGAAGACCCGCGCGCACGCCAGGCCGCTGCCGGATTGTCACTGCCGCCGTCGCCACACGCCCGACTCTCGTCCAGTGGGGCTGTTGCCACCAAA
CACAGCTGCCGGCCCGACACGAATACGCCAGCCATCGCCAACGGTCGCCAACCCATCGCAAACGGTCGCCAACGGTCGCAACAGTCGCAATCTGCAGTGC
AACAACGAGTACACGCCCCGCCCCACCTTCGAAGCCGCGCGCACGCCGGCCGCTGGCGATGTCACTGCCGCCGTCGCCACCACGCCGATCTCGTCCAGCG
GCCTGCTGCCCCAAACACGCTGCCCGGCCGATACGAATACGCCAGCCCATCGCCAAACCATCCGCACCACGGTCGCCAACGGTCGCCAACGGTCGCATGT
GCATGTGCATGTGCACAACGAGGTACACGCCCGCCACCTTCGAAGCCGCGCGGCACGCCGGCCGCTGGCCGATGTCACTGCCGCCGTCGCCACCACGCCC
GACCTCGTCCAGCGGCCTGTGCCACCAAACACGCTGCCGGCCGGACGAATACGCCAGCCCATCGGAAACGGTCGCCAACGGTCGCCAACGGTCGCCAACG
GTCGCCAACGGTCGCCAACGGTCGCATGTGCATGTGCATGTGCACAACGAGGTACACGCCCGCCACCTTCGAAGCTGCGCGGCACGCCGGCCGCTGGCCG
ATGTCACTGCCGCCGTCGCCACCACGCCCGACCTCGTCCAGCGGCCTGTGCCACCAAACACGCTGCCGGCCGGACGAATACGCCAGCCCATCGGAAACGG
TCGCCAACGGTCGCCAACGGTCGCCAACGGTCGCCAACGGTCGCATGTGCATGTGCATGTGCACAACGAGGTACACGCCCGCCACCTTCGAAGCTGCGCG
GCACGCCGGCCGCTGGCCGATGTCACTGCCGCCGTCGCCACCACGCCCGACCTCGTCCAGCGGCCTGTGCCACCAAACACGCTGCCGGCCGGACGAATAC
GCCAGCCCATCGCCAACGGTCGCCAACGGTCGCCAACGGTCGCATGTGCATGTGCATGTGCACAACGAGGTACACGCCCGCCACCTTCGAAGCCGCGCGG
CACGCCGGCCGCTGGCCGATGTCACTGCCGCCGTCGCCACCACGCCCGACCTCGTCCAGCGGCCTGTGCCACCAAACACGCTGCCGGCCGGACGAATACG
CCAGCCCATCGGAAACGGTCGCCAACGGTCGCCAACGGTCGCGTGTGCATGTGCATGTGCACAACGAGGTACACGCCCGCCACCTTCGAAGCTGCGCGGC
ACGCCGGCCGCTGGCCGATGTCACTGCCGCCGTCGCCACCACGCCCGACCTCGTCCAGTGGCCTGTGCCACCAAACACGCTGCCGGCCGAACGAATACGC
CAGCCCATCGCCAACGGTCGCCAACCCATCGCCAACGGTCGCCAACGGTCGCCAACGGTCGCATCTGCATGTGCACAACGAGGTACACGCCCGCCACCTT
CGAAGCCGCGCGGCACGCCGGCCGCTGGCCGATTTCACTGCCGCCGTCGCCACCACGCCCGACCTCGTCCAGCGGCCGGTGCCACCAAACACGCTGCCGG
CCGAACGAATACGCCAGCCCATCGCCAACGGTCGCCAACCCATCGCCAACGGTCGCCAACGGTCGCATCTGCATGTGCACAACGAGGTACACGCCCGCCA
CCTTCGAAGCCGCGCGGCACACCGGCCGCTGGCCGATGTCACTACCGCCGTCGCCACCACGCCCGACCTCGTCCAGCGGCCTGTGCCACCAAACACGCTG
CCGGCCGAACGAATACGCCAGCCCATCGCCAAACCATCGCCAACCATCGCCAACGGTCGCCAACGGTCGCCAACGGTCGCATCTGCATGTGCACAACGAG
GTACACGCCCGCCACCTTCGAAGCCGCGGGGCACGCCGGCCGCTGGCCGATGTCACTGCCGCCGTCGCCACCACGCCCGACCTCGTCCAGTGGCCTGTGC
CACCAAACACGCTGCCGGCCGAACGAATACGCCAGCCCATCGCCAACGGTCGCCAACCCATCGCCAACGGTCGCCAACGGTCGCCAACGGTCGCATCTGC
ATGTGCACAACGAGGTACACGCCCGCCACCTTCGAAGCCGCGGGGCACGCCGGCCGCTGGCCGATGTCACTACCGCCGTCGCCACCACGCCCGACCTCGT
CCAGCGGCCTGTGCCACCAAACACGCTGCCGGCCGAACGAATACGCCAGCCCATCGCCAAACCATCGCCAACCCATCGCCAACGGTCGCCAACGGTCGCC
AACGGTCGCATCTGCATGTGCACAACGAGGTACACGCCCGCCACCTTCGAAGCCGCGCGGCACGCCGGCCGCTGGCCGATGTCACTGCCGCCGTCGCCAC
CACGCCCGACCTCGTCCAGCGGCCGGTGCCACCAAACACGCTGCCGGCCGAACGAATACGCCAGCCCATCGCCAACCCATCGCCAACCATCGCCAACGGT
CGCCAACGGTCGCCAACGGTCGCATCTGCATGTGCACAACGAGGTACATGCCCGCCACCTTCGAAGGCGCGCGGCACGCCGGCCGCTGGCCGATGTCACT
ACCGCCGTCGCCACCACGCCCGACCTCGTCCAGCGGCCTGTGCCACCAAACACGCTGCCGGCCGAACGAATACGCCAGCCCATCGCCAACCCATCGCCAA
CGCATGTGCATGTGCATGTGCACAACGAGGTACACGCCCGCCACCTTCGAAGCCGCGCGGCACGCCGGCCGCTGGCCGATGTCACTGCCGTCGTCGCCAC
CACGCCCGACCTCGTCCAGCGGCCTGTGCCACCAAACACGCTGCCGGCCGAACGAATACGCCAGCCCATCGCCAACGGTCGCCAACGGTCGCCAACGGTC
GCCAACGGTCGCCAACGGTCGCATCTGCATGTGCACAACGAGGTACACGCCCGCCACCTTCGAAGCCGCGCGGCACGCCGGCCGCTGGCCGATGTCACTG
CCGCCGTCGCCACCACGCCCGACCTCGTCCAGCGGCCGGTGCCACCAAACACGCTGCCGGCCGAACGAATACGCCAGCCCATCGCCAACGGTCGCCAACC
CATCGCCAACGGTCGCCAACGGTCGCATCTGCATGTGCACAACGAGGTACACGCCCGCCACCTTCGAAGCCGCGCGGCACGCCGGCCGCTGGCCGATGTC
ACTGCCGCCGTCGCCACCACGCCCGACCTCGTCCAGCGGCCTGTGCCACCAAACACGCTGCCGGCCGAACGAATACGCCAGCCCATCGCCAACGGTCGCC
AACGGTCGCCAACGGTCGCATCTGCATGTGCATCTGCATGTGCACAACGAGGTACACGCCCGCCACCTTCGAAGCCGCGCGGCACGCCGGCCGCTGGCCG
ATGTCACTGCCGCCGTCGCCACCACGCCCGACCTCGTCCAGCGGCCTGTGCCACCAAACACGCTGGACTGGTGGGGGCCGCGCTACAAATACGTTGAAGC
GTACAGCTGTACGACCTTGAGGGTCTGTTGTTGAAGTCTCTCGAAGTGTGAGTGTGGGTATACAGAGCCTGCGCGGTATCTTTAGTCCGCTCATAGCGCA
CGTAGCTTAAGAGAGGGTAGATTAGTCCTCGGTCGTTTAGCCCCGACGCGGCCGCTGTGAGGGCTTCGGGCCGGACTTTACACCTGCGACGACACAAGGA
AGCAACTGGCAAGTCCGCCTACATATTTTGTGCGCAGCAGTAGTTTAGCTAATGGCAGGCACGCTGTTGTTACCAACCGCCACCATTTCCTGTCTAGGAA
CAGTCTCGAAGTAACGTACCGTATAATACTTCTTTGATCCGACAACTTCTTATATCCGACATCGCCCACCAGCCAACTAAATCACAGCGAATTGCACCAG
TGAAAACAACTACTTCTTTTATCCGACTGTACGACTAGTGTACCAATATTGCGGCTGTCACCACCATTCACTAAGTGCAATGGCGAGCATAACTCGCTCA
CGACGAGGACAGCGACGCTGTACTGGGGGCAAAGGAGCACTGATATGATAGATACGCAAGTTGGCCAAGTCCCAGATAGACAAGATGTGATCTCGTCGCT
GCTTGACACTGACCAAATATATGTAGCCACTCGTTTTCGTTTGACGTTATTTACTTGGGAACGCGTGTATGCATGTGTGTATGCATGTGCGTATGCACGC
GTGCAAGCCGTTGTGTGTGGGTGCTTTGTGGGCTCGGGTTCGCTTCCGGGGCATAACCCTTCTCCAGAACACGATGCTGACAATCATTTTTCATTTTGAC
GAGTTTTTCATCAAAACAGATGTTTGAAAATCATATGATACGAAAATTGCAATCTTGCCAACGTTCACTTACCCTACACCTATCCGAAGATTTAGTGTCG
GATCAAAGAAGTATTATACGGGTATAGGCGTAGCAACAACATTCGCCGGAGCGAACTGACGAACAAAGCAGGTCATACAGGGGCCTTCTAATTGAAGCTT
GGCCCAGTGGTACGTGCGCCGGCCACCGAACGACAGAAGAAAAGAGGGATGAACGGAACGGAACGGACGAGAGTGAGTGAATGAGTGAGTGAGTTAGTTA
GTTGGTTAGTTAGTTAGTTGGTTAGTTAGTTGGACAAGACTAAAAAAGGGTTCAGCAAAACTCGGCAGTGTGGTAATTGAAGCTTGAGTGGACATACTGA
AAGAGTGGTGAGTTAGTTAGTTGGTTAGTTAGTTAGTTAATTAGTTAGTTAGTTGGTTAGTTAGTTGGTTAGTGAAGAACGGAGCGGAGTGAGCAGAAGG
GGTATATTGAGCAAGAACTGAGCAGCACGTGAGAAGAACAGAAGACGATGGCAGCACGATCAGCATGCGCTTCACGACGATTGGGTAGGCATGATGACAC
AACGCTCGTCGGTGGAAACGACACCAAAGCGTACGCGTCAACCGAGAAACGCCTTCAACTGAATACTGGTGACGGGACCCCAGGCGAGAAGGAGGCCTCC
GTCACCAGCGAAGCAGCGGGAACGGATGGACTGAACGATGACTCCAGCGATGAAGACGCCGAGAGCAACAACAGTGCCAGCGGGGGCAGCGACAACGGCT
GTCGTGGTGGAAGACAATCAAGCGATCAGAGAGGACGCCACCCTCGAACCAGACCCCATATAGACTCCTTAGTAGCCTACACGCGCGACCGCAGCCGTTG
TCGAAATACTCCGGCATTTCCATGTAAATCTCTACGTCGTCCCCGATCGGGCCGTTCAAGAATGCCGTGACAAAATCAATGTGCTTGCACAACAGACCGT
AATGCAATGCTAACAAAAACAACAACTTGACTGCTTCGTACAAGACCTCCGGAGCGTACGTCTCTCAAAAAATCCACCCCGTACTGCTGCTGGCAGCCTT
TGATCGTAATGCGCGTGTGGTGGCGGATCACCTGTCCCTTCGGGTTCCGCTTCCTCACGAAGATCCACTTGCTAGTCAGAATCTTCTTCCCCTTTGGGCG
CTCCACCAGTTCCCACGTGTTGTTGCGTATCAAGTCAGAGCACTCCTTCTCCAAAGCTTCCTTCCACTTGTCAGCAGCAAGTGCTTGAAGAGCCTCCTGA
ATACTCTGTGGCTCCATGATCAAGTTCACAGCTTGCGCCACTAGACTCGCGGGAATTTCACTTCATAGTCCTGCAGTCGGACATTGGGACGACGAACACG
TGACGAACGGCGAAACGATGTTGCTGCGCGCGAGGCTTCATATCTCCACCCATCGGCTTCGTCGTCGTCTTCACTACAAAGCCCTCGTACGACGTGATGC
GATCCAGCAGATCGGCCGGGTCTCCAAAGCTAACATCCCCCTCATATCGATCGACATTACCAGCATCAGTTTCATTGCCTGCGAAGTAACCGCTATCGTG
GTCTCCCACTGAAGGCGAAGCCTGTCGATCCGGCGGAGATCTGGCCGTTGCCTCCCGTCGGAACCTCTTGCCTCGTTATCAGCCAGCAACCAGGCGCACC
TGACGTTGCCAAAGCAGCAGATTCATTTCTTTCATCAGCAGGACAACCACAGCTAGCGTGAATTTCACAACACTGACGCTTTGAAGGGCCCGTGCAATCA
TCATGAGAGCAGCGCTTCACGCCAGAAGTCTCTTGATGCATAACCGGTAGTCGTACGTAGGGTATGATCTGAGGCAACGCATGCCGTCCTCGACCATAGC
GGTTTGAGAGTAACTTGATCGCATACAAAGTTTCCACAGTCCAGTCTTCTTCAAACTCGACTGAGCAAACTTCCACAATGTTACCCGTAATCAAGTTCAG
GATGTGACAGCTCTCTGAATGTTTCGCGTACCCTACAAACAACCCCGGCTTCCCAGGGTTTTCCAGCTTGCTCTTGCGCAACACCTTGGGCGTGAAGATG
AAAGCTATGCAGTCCCATATCTGCAACGATGTCATATCCGGCCGCTCTCCGAAGCGGCGAAAGTATGTAGTATCACATTGTTTCCGCTGATGTTCATCAC
TTCAATAGCCAACTCGAATGCTTCACCCCAAAGCAATCACGGCATATTGGCCGCAGTCGGCAAACATCGAACACGAGAGAGCACCACTCCGTTCATTTTC
TCCACCAACCCGTTCTATTCCGGACTATATGTGTTCATCGTGGTGTACTCGATCCCGCTGCCCTGGAGGAACGTCTTCAACTTGTTGTTGAAGAGGTCCT
TGTCTTGGTCCGAGTTGAACACCTCCACCTTATTTACCTGCGCTATCACCCACGTCAAGTGAGCCAGAACCACACCAGAAGAATTCTCCTTTCGATATAA
CATAAAGCCCCAGATATAGCGACTAGCCTCATCCTGTATCAACTGAAAGTGCTCATAGCCATCGTAAGTGACCTGCACATGTCACTCATG