Description :
From Genome Similarity Track
Location :
Scaffold_3097:24- 2535
Sequence
2511 bases(100 bases per row)
TTAGCCCTCTGCAATCCTTCATCCACCGACCCTGCGTTATCTAAGGGCCGACTCTGGGGATCGTCCCCCGTCGTGGATCCAACCTCCATTGCTTGGATCT
CAACCCGTCGATCTCTCTGCAGGATCTTTCGCGGAGTTGGATATGAAGGCCGATCCACCAAGGGGCCAGTTGGCTCCGCCGGGAGCTCCACCTCTCCGAG
AGATTCGATCTCGGTAGTCGCCTCGTACACCAGATTCTGCCATTCTTTGTAGCGGCGGGATCCCACTGACACATATCCAGGTCGCCTAGGGATACCGTCC
TTCGCCAACCATCGTCCGATCTCCTCATAATGGTCCAGTAATAGTCTCTTGTCGCTGACGTTCGTGACCTGGAGGTATTGCGATCGACCTGGTCCTTGGA
CTACGGTAGGTACCCATTTCTCGCCCCGAGTGACCCACAGTTTCTCATGTTCCACCCACTTTAACCGGTCTGGCAGCTCCCAGGTTTCCCCGGGCTCGAT
CCAGCCGCCCTTATGATCCTCATCTTCGCTCCATACAACGGCCGCCGTCCGCTGAGCTGGATCCGCATCTCGTCAGGGAAACAAAGTGTCCCATCCGCCA
GATCCAACCTCACTCCGGCTGGCACCAGGGAAATCCATCCCAAGGATGGCGTCTTGACCAGCGAGATCCCCGACCCAATGTCAAACCAATACACCAAACA
ACCTGCCAGCGTGATCTTGATTCGCGTTCTTCCGTTTGTACGGTATACGCCTTCACCAATCCCAACACAATCTTGGATCCGACTCCCATCCACTTGGCAC
CCTACATAACGAGCAAAGGCGGTATCCAGTATAGACACCTCGGCACCACTATCTAGAAGTAGGATTGCTTTTTCATTGTTGATCTTGCCCCCTACCTTGG
CTTGTCTGAACCACTTTCCTGGGGCATGGTACTTCCAGTATCCACGGGACTCCCCTGTTAGCAGATCCATGGATCCAACATCCTCAGATCCACAGGATCC
AGTGACCAGACAGACCTTAGGTGGATCTGCAGTGACCTCACCCTTGGTAGGCTCAAACCATCGACCATGTTGGCGTTTCTCCCAGTAACCACGTGTCTCT
CCTCTTTGTAGATCCAGGGTTGAAGAGACTTTGGATCTGGAAAACTCGTCCACTTGGCGCAAACTAGAGACCTTGGCAACTGACACTTCATGTAGATCAC
GTGTATTATCGACTGGATCTAGGGTCCTGCTACCTGGATCTAGCGATGTCTTGTTCACAAATGCATAAATGCAGTACCTAGAACGCTCGGCTCGTACCGG
ATTCAAACCCGGCGAGCGTCCTAGTTTAACATCTTCTCTGCCACTTCCGGCAACATCCCTCGGTGCTTGGCTGGATCAAACCATTGGCGGATCTGGTTGT
AGAATTCTTCCATCGGGCACTTGCCGACGTCGTGAATCTCGCCACACCCGCGACACACGTAGAAGCAATGATCCCCGGGATGACCTTTCTTGCCACACTT
CTCACAGACCAGATGTTTCCAGCATCCAGATTCAGTGTGCTTCCGGGATCCGCACTGCGAACACCTGACTTGTGCTGTCCGGTCCATGAGATCTCGGGAT
CTGTACATCCCACGGTCCCCGAGTACGGTATCCCCCGGTCGAGAGTTGTCTCCTGTCTTCGCCGTTCGATCGTTGGACGCAGTGAGACAGACTCGACGGT
AATCTTCAGGGTCGGAGTCCGAGCCGTCGGATCCTGACTCAGTTCCTGAGTCGGGCGCCGTGACTTGGTGGACACGTCGAGCTGGGGCCGTAGGCGTCGG
AGCCTTTTGGCGATACTTGCCGGACCCGACCGCCGCCTTCTTCTGGCGGTGTTTCGCGCGATCCACAGCCCGCAGCACTTCCTCAAGCTCGTCTGCGTCG
GGAAGTCGCAACAGGGTCAGCCTGTCGGCCAGATCCACGTCTCCCAACGTCTCGATGAAATGATCCACATGTTCCCGCAGTACCTTGGATCCCCCATCCT
TGATCTTCAACTTGGCCCGTAGACCGGCCACATTTAGTCGATGTAGGTATTCCAGCGGGGATTCATCCGATCTGCGGCGAGCATGGTAGTATTGTCGTGT
CACCGACACTCCTAATCCACAGTGCTGGGTCTGGAAACTGCGCAGCAAATCTGGCCACTTGTTCCTGGTGGATCTGCCCAGCTGCCGATATCAATTCCTG
GCTGGCCCCGCTAGCAGATCCGCAAAGGTCAGACACTTCTCAGCATCCGACGCTTGATCTCTCATGAGGACCGACTTGACTTTACTGATCCATGTCCTCG
CTCGGTCCTCGTCTTGATCCTTGCCCGTGAACTCCTTCAGATCCGATATGGCTGAGATCCGTGCCCTCTGGATCATGGACGGTCCACCTGCCCCGGCTGC
AGCTGTTGCTACCACCGCTGATGAAGAGGATGGGCCATCCAGATCATCTGGGTTGAGCTCATCATGGGAGTTGTCTCCCTCCACTGACTCCATCTCCACG
TCTCGTGCTCC