Description :
From Genome Similarity Track
Location :
Scaffold_4072:24- 2156
Sequence
2132 bases(100 bases per row)
TCCACATTGCCCTCGAAAACTTCATGTGCGGACTGGGAGGGTTTCAGTTGCTTGTCATGTTTCTGGTTTTGTTGTACTTGACCGTGGCTGAGATCACTAG
AGCAGTTGCTGTAGCTCGGTTGCGTCGTTGTCGGTCTCATACTGACGCACGAGGCCTGGTACATCATGGACGATGGAGTCGAAAGGCTTTCAGAAGTTCT
CGACTTCCTCGAGGCCCGCCATGCAATGTTTAGCTCCCAGTCACCCGAGCGTGCGTTCCAGCGATGGCCTTCAATGCTGCGAACACCAAGTACAACACCT
TGGGTTGCGATGTGCTCGTGGATCTCGGCGGTGATGTTGAGATCAGAGTCGCTGTAGCACTTCAGACGCGAGCCATGTACGTCGAACTCGTCCCCAGTCA
GCAAATGCTTGATGAGGAACGAGTGCGAGAGGGCTTGCACCACGCGAAAAGGTCCCACCCAGCGCACCAGCAGCTTGCTTTCTCGAAGCCGCTTGTCCAC
GCGAGGCCGCAGGACGAAGTCACCTGGCTCAAAGTTGCATTTGGTTCCGTTCTTGCGTGCCATCTCGTATAGACGCTTCCGTTCTTTGTGGTCAACGACA
TCCTTGTACCACGAGTGCAGGTGCTCACGAAGCTCATCGACTTGAGCTCGCAGCAGCAGCTCGTCACTGACAGTCATCAGACGAGGGCTGGAGTCGCTGG
GTACCGTAATCACATTCAACAGCGAAGGGGCCGGGAGCCCGGTAAACAACTCGATCGATGCACGATTCCCGAGGGATTGCACTGCAGAGTGGTTGAGGTT
CGCCTGGATCACGGGCAAGAGGTAGTGCCAATTGCGTGTGTCGAGTCGGAGCTCGAGCAACATCACTCGCAGGACCTGCAGAATGTCACAATTGACTCGC
TCTACGGTTCCGTTGATCCACGGCGTGTAGACGGGCACGAATGACTGGACCGCCTTCAATCGCTGAGCCAACTCCTCCATCACTTGAGCCTTAAAGTGCG
AGCCGTTGTCGGAGACCCATGTCTCTGGCAGGCCGAAGCGTTTGTACCAATCCAAGATTGCCTTCGCGGCTGCCAGACTGGTAGGAGCATCAGCAGGCAC
GAGCTCGCAGTAGTGAGTGAGCCCGTCCTTCAAGACCAGTACGTACTTGGTGCTGCCGTAACTCTCACCAAGGTACAAGTAGTCCATGTGAAGACGCTCA
TTGCGCTTTGTCGCCGTCCACGTCTCGCCCCACACGCGCTGGATTAACTGTCCGCCCTTGACGTGCTTGCACAGCAAGCAACTGCGGTTGAACCGAGCAA
CAACAGAACCGAGACGTTCCAGAGCGAAGCGCTGCTGAAGGGCCGCGAACATCGCATGCTCGCCTCGGTGGCCTTGCGGGCCGCAGTGAGCAACGATCAG
GATCCTTTGGATCAGCTCGCGCTCAAGGCTCAGGAGACAGAGCTTCCCATCAACGTTCACAAAGCCATCCTCATCTTCAGGCTCGGCTGGCGCCAGCTCG
ATGTGGCGGCGTTGAGCCATCCGGATTGCCTCCTTGGTCGGCCACTCAAAGTTCTCATCGTGCAAAGGTCGTAGCACAGACAGAGCCACCGTGTTGCGCG
TGGACACACGCTTGGCAGAGAGCGTGATCACGGGTAATTGTGGCCGTTACTGGCCCCGCCGAAAGACAATGTCGGCCCAGAGGTTGTCTTCACCCTTGAT
GTGCTCGATTGAGTAGCGAGTCCCCACCATCTCCAAAGCCCAGTGCTGCAGTTTACCTCGTACAGGTTGCTTGACTTCCGTCGCCGGACTGAAGATCTGG
ATCAGATTGGCATGGCCACAGTAGACCTTGAAACCACGTTCTCAGTCTAACAAGTAAGAGAGATCGGCGCACGACTTTACGATCGGATACGCCTCCTTCT
CCACTATCGACCAGTTAAGCTCGGCGTTCTTAAACTGGCCGTCCTTGCACACGAGCATTTGGTGGTATTGCTCACCACCGGCTTGTCTTGCTGCCAGTCC
GAGACCTGCGTCAGGACGGCGGCCCACCCAACGTTCGAAGCGTCAGTGAACAGGCAAACCTCTGCCTTGTCGTCGACGAAGTGCTTCTTGGTGGACGTGG
CCAGGAGTTGCAACACGACCTGGAAAGCTTCT