Description :
From Genome Similarity Track
Location :
Scaffold_341:24- 2067
Sequence
2043 bases(100 bases per row)
TGGTCAGGTGTAGTAGTCACGCGAACTCGACGACGATCCATATCTTCATCAGATCCAATTATTTCCGATTCCGATCCACTGCTTTCGACTTTCTCGCGGA
TCGCTCGCACCGCCCGAGCTGTCTTGGACGAAATCGGATTTGAAAACGTGGTCGTCCGCTCATGGAATTTGTTTGATCCCATCGATGCTTTCATCTGTCG
ATTCTCCATCCGTTGGCACGCACGTAGGGGGGTTTCCTCCACCTCGTCAACATCCGTCAATCGCAGAAGTGTCAGCTGTTTTGCCAGATCGCGATCGTCC
AGTGTAGCAATGAAGTGCTCCACATGTTCGCGACATGTGGCCGAGGTAGCCAATCTTTCTTCTTTGATCGAGATCTTGGCGTGCTTGGCTGCGACATAAA
GGCTATACAGGTATTCCAGCGGGGTTTCATCCGATCGCTTCCGTGCAAGATAATATTGCCTAGCCACAGACACCCTGTGCCCTCCATACTAAATCATGAA
ACAATCCAGCAATCGCTTCCACTTGTGCCGAGTCGATCGACTCAGTTGGTTGTACCAGTTTCGTGCTGGACCTATCAACAGATCGCTGAACACGAAACGC
TTTCTTCTTCCGGCGCCAGATCGCGCAGGAAAGACGATTTGACCTTGCTGATACAGCTTCTGGCCTTATCTTCATCTATGTCTTTGCCACTGAATTCTTT
CAGTTCCGTCATCGCTGACACGCGAATACGTTGAGGAACGCCACCACCATTCCGAAACGTTTCTGCTGTGGCCATCATCGCACGTCTCCGCTCTTCTTGA
ACCGAATCCTTGGGGTTGACGTCTTCCGGGTCAAAAACGTACGATCGACTGCGATGCGATCGGACAGATTCCATCTCGACATCTGAAGTGTATTCTTCTT
GAACTCTTGGAGTCTAGATCCTTTGGCTAGGATAGATCTCTTGATACGCTCGCTCCCTCTGTTCTTGTTGAAAACGTTCCATAGACCCTTCAAGGTACGC
CTGCAGGTGTCCTTACGTAGTCAAATTCGACTCTCGTTGAGCACGTGCGGTCGTCGATCATGGTTTGATCTTGATCGTTTTAACCCGATCGCGCAGATGT
GCCGCCCCATTTGGGCCTAGAGACATTCGCTGAATACCGATCGAGTCATCCGACTCGATTTCAGATTCAGATTCAGCTGACACGTACTATGACGATACGG
TGTGGTATCCTCTCGGGGTGTCTACGATATCTGCTTTTGCTTGATCCGTAGGATCACACTTACCCGTTAGGGGAGTTAACTTGTCGTATAGCGATTGATA
CGCGTGGGTTATTTGATCTTGACCGCACTCCAACATTTTGTTCGCGTCGAACACCCCTGCGACAAACCAGCGTCATGTAGCAGCCGTATGATCCCGTTGA
TCTCTTCCAGCATATCAGACGCTACTATCGGTGGAGGTATCAGACCTTGGATTCCCCGATCAGCTTGGCATTCAGAATCCTGAGCACTGGGTCACTTGAT
AGAAGATTATTAGTTTCTTCCAGTGGTATTCCTCCGCCAACTTATCCAGCTACCAGCCTTGCACCTTCTTATTGTAGTCCACAAACTTGATCGGTCGGTT
GATCGATTTCATACTGTGATCGTGCGGGATCCGATCTTGTCGCTTCTTTCTTCACTCATGCTGCCTTCACGTGTTACGTCTTTGACTTTGCTTGAGTGGT
CTTGGGTGATAACTGTTCGGTTTTATCCGAACGGCTTTCACACAGCAGATCGTGCTTTGCGGCACGATCCGCGGTGATACCCGAAGGGACCTCAGGAGGG
GTCGAGGTTTCTCTTCCAGATCGATCGATCGATCTTCCTCTTTGATTTTCTTGTCATCAGAGCCCCTCCCAAAACTCCGATAATCTGGGGATCCTTTAAA
ATCACGCGTCTGCGGCAATCGCTCTGCCTCTGACGCTTCCATCTCAGGTTCCGTCTTTATTTTCACCTCTTCACTCCGCGACTCACGGCAAAATCCCGAG
TCACCAGAAGGATCCGGACGCGCGCACCATTGTGGTGGAGTGG