Description :
From Genome Similarity Track
Location :
Scaffold_559:24- 1244
Sequence
1220 bases(100 bases per row)
AGTCATCTCGGCGTAATTGTGCGAGTATTTGTGCAAATACGCCGCTAGGCCAAGGAACTTTCGAAGTCATTTTATGTCGGTAGGCACCGGCCAGTCAGTG
ATCGCCTTGATCTTTTCCGGCCGGACGCCATGTTTACCCACGATGCATCCAAGAAGTGGTATTTCGCTTGCATCAAATATACACTTCTTGAGATTTTGGC
ATACAACGTATGCTCACGCATTAGTGTAAGAAACTTTCCGGACGTGGAGTCGGTTGACTTCCAAATCCGTCTTTCCATCCATAGCCCGGCTATGGACGAA
CCCGTCGTCGAAATAGCTGGGTGCAAATTCTCGCACGGATCTCAACAGATTTGTAACACATCTGTTGAATGTAGCAGGGGCATTACTCAGCCCTTGTGAC
ATTACTAGCCGCTCCCAGAGCATACCGCTTGGGGTGCTCACTGCTGTATAAGGAATGTCCTTTTCGCGCATAAAGATCTGATAGAACCCGTCCATCAGAT
CCATCGATGAAAAGATGGTACTCCTTGACATACCATCTATAATGACATCCTTTCTTAGTATCGTCGTTTGAGCCGGTATAGTGGCAGCTTCAACTTGTTG
AAGGCATGTAGTATCCGCCATCCTCCTGTGGCCTTTCGGACACAGAAGGTCGGAGAGCTATGTGGGGAAGTAGATTCCCTAACATGGCCCACTGCCAAGC
GATCGGCAAAGAATTTGTCAATCGCTAGTGCTTGTTCACGAGGCAATGTCCATTGCTTCATGACACAGTACTTTCACCCTGGTTTCAGGTCTATCTCGTG
ACGAGCACCCTTATCCTTGGGTAGCTCGCACGGCACTGTTTCTGGGAACACATCCCTGAATTCCGTCAAATCATCGTAGAGAGGATTTGTCTTAAGCGAT
TTCCACGATCGGGATGTATATAGCTCAATCCGAGTCTTCTCATCAAGGCCACTCTCGTCCATTGATGAGCTGCTGAGAACCCTTTCGTTCTCAGCGAATA
CCATTTCCGACCGAATATCGGTTACGTACTCGTCTTCCGCGACAAGTACGCAAATCTGCTTGACTTTGCCATTACGCAGATCACGCAAGAACCTTTTCTA
TTCGAGCGTGAGCAATTAATGATCTCCGAAGTTGTCTTCGGAGGCGCGATCAGATCAAGTTGGTAAGTTCCTATACTTGATCCGTCATTGACTAGGACAT
TTAATGCCTCTGTTGTCTCC