Description :
From Genome Similarity Track
Location :
Scaffold_4419:24- 1183
Sequence
1159 bases(100 bases per row)
TATCAGAGTCTTCTTCGACTCCTCGGATGAAGAGGAGGAGATGGAGGAAGAAGAGGAAGAGGAGGGTGCCATTGTTGAGCCCCGGGAGGTCTCGAATGAC
CTCGACCAGCAGCAGGAGGATTTCCAAGCTGCCCAGCGTGTGCGTGGGGGTTCGGTGGCGGCACCCGTCAGCCAGGGAGCTGCCATCAACTCAAGAGGGT
ATTGGCCTCCCGAGGAGAGCTCTGGGGCTGACCTCTTCTTAGAGCTTCTCGTCGCTCCTCGTGGCCTTGTGGGCGGCCACACTTCTAGGGGCATCTATGA
ACGAGCCCTTGTTCAGAAAGAACAGTTGTTCGTCGACAACGTGGAGGCTGCTCGGTGTGTGCTTCTCGCACCACACCGCATTCCCCTTAAGGACTTCACG
ACTTGTCGTAAGAAGCCCGAGACCCGGGGTGGTCTCTATCCTGTTTGGGGATACCCCTGGGTTATGCCCGAGAACTGTCCCACATGGAGTTCTTGTGAGG
ACATGTTCTGGGCGTGGGTGGAGACTCTCAAGTACTCGCCCACGGAGTTATGGGAACTCCATGAAGATCAGCAGCTGTCCCACATCCTGGACCAGCGTGA
TCTTCGTGTGAGGTTTGCCCACTTGATCAGCAAGCGTATGCTGCCAAGGGACATCCTGAAGCGCGCGGCTTCTAGCGCTCACGATGAGCGCGGGTACGGT
ATGTATTCATCATCCGTACCCCGTTCGGGCAAGAAGCCCCGGACTACTTATGAAGCTGCCGCCGCTTCTGTTCCCAGATTGCGACAGCCTTCGGGCAGTC
AATCAGGAGCCGTTCAATCGGCTCCCACGAGTTCTCGGAGTGGGCATAACCCCTCCACTTCACGAGGAGCTGTCGCTTCCCGCGACACCGTTGCTCCTGG
AGGATCCGCTCCACGTGGAAGTGGACTTCTCCATTCCGGTCAAGCAGGGGCGGAGGTGCCCTCGTACGAGTACGAGTACTCGGCGCCTCCCGAGAGCCAC
TCTCGTTCGAGTGCTCCGACTGCGGGTCCGACACGGGACCCTGAGGTTGACCGCCTCCGTCAACGTCTCCTCGTGCTTGAGATTGCACTTGGCCTTGGGA
CTGGCGGTAATGCTGCCGCCCAGGCCGGGAATCAGGGCGAGCTCGCTCGTCTTGCGGGT