Description :
From Genome Similarity Track
Location :
scaffold_1078:24- 1090
Transcript NameFunction/comments
g10951.t1 heat shock transcription factor

Sequence
1066 bases(100 bases per row)
TCCTTGCTGCCTTCTGCTTCAGCTTCATCTGAGTCGCCAAGACATCGAGCTGCGACAGGTGGCACCGGACGAGCACGTCGTGGCTGAACGTGGCGACACT
GGCACGCGTCTTGGTCCACTTGTGGAAGCCGAAGTTGTTGAGCTGGCGCTGGAAGCTGGAGAACTTGCCGTGCTTGAAGTACTTGCGCAGCACTTCGGTC
TCCAGTCGTGGCACGTCGAAGACCTGGAAGTGTGATCCGTCGGCTGACCACGACAGGATGCGCTGGTCTTCGTCCTGCAGCATCTCGTAGACGGCGCGCA
CGAATCGAGGCGCAGTGGTGAAGGCCTTGTCGTTAGGTGTAGTAGTGTTCGTTGGCGTGGTAGTATCCATCTTGATGTTTATCGCGGTCGAGTGGAAGTT
TTCTGCTAGTGTGGTTGTTAGTTGCTAGTGTGGCTGGTGTCAAGGTTGGTCGTAGTGGTTTGAGTGGGTGGATCCCAATTGAGTTGTGACGGAACTCAGC
GTCGTCCGGTCGCAGACGCGATAACGGCGATAAATAATCTGTGCGAAGTACACAAAGGCTCTACGCAGATTGAACAGTAGTTAACTATGCATGTGTCTGA
GCTCCTTCTCGACATCTGGCTGCAATACCTCGTGGTGTTAAATTCCACCAGCGTGTGGATTCCTCGCCAGCACTTGTTTCAGCTGTGCAGTTGGGTTTAG
TGTTGGCTCAAAGAGAGCGTCGATGAATACTAAAGCTTACCCAGTGGTAGTGTCTGGTGATGTTAAGTGGCAATGAGTAGCATTCATTGAGTACGCTTCA
ACTGGCCTTCTCTTTACTATTCTTCCTGAGTTACCTGTCGTTTCCTGAAAATGGAAAGTGTAGCTATCTTGGAACTGTCGAAGCACCTGCACTTACAGAC
ATGCGACCACCAAGACGTCACTTCAACATCGAGGCTAGCACACGCAACACCAGTTATCGGGGCTTCAGCTTACTAGTCGAACATTACACCTGCCAATTCC
AATAGACACCGCATGATCCTGGCAGGGTTTCTGCAGCTGCGTTTTCTGCGCATTCCGCTAAAGCGT