Description :
From Genome Similarity Track
Location :
contig_33:239998- 241773
Transcript NameFunction/comments
g6478.t1myosin-like protein

Sequence
1775 bases(100 bases per row)
ATACGTACACTGGTCGAATCTGTATCGCAGTAAACCCGTACCAATGGCTGGACCTGTACTCCAAGCCCACCATGGAGAAATTCAGTGATGGTAAGCGCGA
GAACAAGCCCCCGCACGTTTACGCCGTGTCCATGGAGGCGTTTTTCAATATGCGGCAAAAGCAGGAAAATCAGAGCATTTTAGTCTCGGGGGAGTCGGGA
GCCGGCAAGACCGAGACTACAAAGATCGTCATGAGCCACTTGGCGGCGCTGGCCACCAATTCCAACTCCAAGGTCATCCAGCAGATCATCCAGGCCAACC
CGCTGCTCGAGTCGTTCGGTAACGCCAAGACTGTGCGCAACGACAATTCCAGTCGCTTTGGCAAATTCACCGAGCTGCAGTTCACGATCGAGGGCCAATT
GATCGGCGCCAGGTCCCGCACGTACCTGCTGGAGAAGAGCCGCGTGACGACGCAGGCCCAGGGAGAACGCAACTTCCACATCTTCTACCAGCTGCTGGCG
CAGCGCAAGAACTTCCCGGAGCTCGAGCTCGACATGGTGGACTCGTTCAAGTACGTGTCGTTCCAGGCACAAGCCCCCGGCGGAGACGAAGAAGGCGACC
TGAGCCGCACACGAGAGGCTCTGGAGCTTGTGGGCATTGAACAGCCATTGCAGCAGGAGATTATTCAGATTCTGGGCGCCGTGCTGCATTTGGGAGAAAC
GGCGTTCACGACCCGCAACGGAGACGTGGATGCGTCGCAATTGGTGGATCTCAAGCACTTTAGCGTGGCCTGTCGCCTTCTGGGCGTGGAGGTCGAGGCG
CTGGAGCGCGCGGTGTGCAACCGAAACGTGTTTGTGGGTCGCGAAGTGATTCTGAAGCCCATGACGCACGACCAGGCGGCGGATTGCCGTGACGCTCTGG
CGAAAAGCCTGTACTCGAAGCTGTTCCTGTGGCTTGTGGAGCAAATTAACCAAACTATTGGTGTCAAGGTGAAGGGCGCTGGATCATTTATTGGCATCCT
GGATATCTTTGGTTTCGAGCACTTTGAGACGAACTCGTTTGAACAGTTTTGCATCAATTATGCCAACGAGAAACTGCAGCAGAAGTTCGTGCAGGACGTG
CTGAAGACGGTGCAAATCGAGTACGAAGAGGAAAACATCTCGTGGTCCCACATTACTTTCGCAGACAACCAGGACGTGCTGAATCTCATCGAAGGCCGCT
TGGGCGTCATCAGTTTCCTGAACGAGGAATCGCTGCTCGCCACAGGCACGGACGCGTCGTTCGCGAGCAAGCTCGGAGCTGTGATGGAGAACAACCCGCT
GCTAGAGACTCCGCGACTGAACAAGTGCGCGTTCTCGATCTACCACTACGCTGGTAAGGTGACGTACGACGCGTCGGGCTTCCTCGACAAGCACCGCGAC
GCCATTTTGCCGGACATCAAGCAGTGCATGAGCAAGTCTTCGCTCAAGATCTTGTCGAAAATGTTCACGGACGATGTGAACGCCAGCAGCGCCAGCAGTG
CGGCACCCTCGGCTCGTGGCAGGTCGCGTAGTAGTAGTAAGAAGGGAGGCCACGCCCAGACGCGCCGCACCACGGTGGGCACCCAGTTCAAAGAGAGTCT
GTCGCAGCTCATGGAGAAGATTGGACTGACGGAGGTGCACTACGTGCGTTGTTTGAAGCCCAACCCGCTCAAAAGTGCCAACTGTTTCTCGCACGGCGAC
ATCGTGAGCCAGCTCCGCTGCGCCGGTGTTATTGAGGCTATCCGTGTGTCTCGTAGCGCGTACCCCAGCCGTATG