Description :
From Genome Similarity Track
Location :
Scaffold_53:23995- 25544
Transcript NameFunction/comments
Sapdi_VS20SDRG_12821hypothetical protein
Sapdi_VS20SDRG_12822hypothetical protein

Sequence
1549 bases(100 bases per row)
GGCCCATCTTCATGCATCTCTTCCGTGGGCTCAACCCTCGTCCCCCTCTTCCTACCTTCCTGCGCAGACTCCCATGGGTCCTCTACCACGACAGCGCGTC
CAACATGCCCTGCTACGTCAACTCGGTGACGCAGGACGTCCTTTGGGGCCTTCCCCTCGAGAGCGAGACGCATACCATCTACCGCGTCGCGCGGGCCGTC
TCTCGAGACCACCCACGCCGTCGACGGGCCATGTCCTTGCCCGACCTGCGCCGGAGCATCACGCACCACACATACGGGCGCATCGACCTGTCCCTACAGC
TCGTCCAGGCGACCAAGGCCAAAGTCGAAAAAGACCGTGTCGATCCCAAGGCGCCGGCGCTCCACGAGAAGGCCCGTGCCTACCTCACCATCGCTCACCT
CCACTGCGACTACATGACGCGCTTCTACCACGAGAACGGGACCGACTACTCGAATGAAAAGTACCGGCACCTCCACGCCTTCCGACTTCCTCCGTACGGC
AGCAGCTCGACGCAGCAGGAGATGGAACCGAGCTCGCTCTACCAGTCGATCGTCTCGAGTGCGCATTACCGATCGTTTGTTGGCAAGATTGAGAACGATA
CGGCGTCTGCTCCAAGTGCCGGACCAAGCCCTGCCATGGAAGGCAACAAGAGAATTCTGGACGACCCCCAGATCGTCGAGGCGCCTCGGCATCGCCAGAA
GAAACGACTCAGCGCCAAGGCCAAGCGTGCCCAGTACCACGCCCGCCGGCTCGACAACGATATCATCGGTGCTTCGCGTGACGTCGACAACAACCAAGAG
GACTTCAGCTGCATGGCCGCGCTTCCTGCGTAGTCCCTTGCCCGTCTGGGAGCAACACTTGTGTCGTGCGACTAACTTGGATATGGATTGACTTTAAACG
GGTTTCGGCATCGTGCACGGGACAAGCGGACTCTGAAACATGGCGCGGTTGTAGGCAATGGACGTCATCGCTTGCTTGGGCAAGCACCACGTTCGCTGCA
TCGCATGCATGCACTGCTCGTCCACCATGGCTTTTGTCAGTCTACAAGAATAGTTAGCAACCTTGTAGGAGTCAGCGTCGTACAGTCGAAGACTCTGGCG
AGCAAATTGATAGAGGTCCTTGCCCGTGACGGACGTCTGCAGCCGGGCCAATTGGCTCGGGTCGATGCCCCACTCGGCCCTACAGGTGCTCAGCCAGTGC
GCGTCATCGCTCGCCGCGACGCGAAGCTGGCGACACACTTGGCCGACGGCGGCAAGAGCCGCGCCATCGAGGTACCCCAAGATCGCCCCAATGCTCTCGT
CCGTGATCCCGCCCAGGATGCCGACTGGCACATAGCGGCGGCGATGGGGGTGCACGACCAACTGGTACTGAGGGTTGACCACAATCCAGTTGTCGGACTC
GTTGCGGGTCGCGTGGGGTCGGGGCATCTTGGGGCCTTTTGGCGCGTTCAGAAATGCCGTGTCCCAACCAGATTTATATGTCGCCTCCCGAAAGCTAAAT
TTGGCGCGACCGCAGTTTGTGCCATATTGGGCGAGCCGTTGGTATCGGT