Description :
From Genome Similarity Track
Location :
Scaffold_47:239912- 247049
Transcript NameFunction/comments
Physo_136665hypothetical protein
Physo_136666reverse transcriptase
Physo_136667hypothetical protein

Sequence
7137 bases(100 bases per row)
ATGACCTGTTCGACTTGGACATCGGAGTGCCAAGAACCACGGCCGCCGTCTCGACGGCGACAGCCGGCGGCGTAGCCCTCGCCCGCGTACGCCTCTCAGC
ATCTTCCAAGCTGAAAGAGTTCTCGGGACGGGACGCCAGCGAAGAGAAAGCCAGACTGTGGCTCAACCGTCTGAAGTCCGCCGCGCGGCGCGACGGGATG
GCGGGCGAAGAAGTGTGCGGGCAGTTCAGCGATCTAATGAGCGGCCCTGCGCGCCAATGGTATCTCCAGTTGCCCAGGAAGGTCAAGAAATCATGGACCG
AGCTGATGGAGCAATTCCGGGTGCAGTACTGCGGCAAGGGCGTATCAATGGCCAGTCGCTACTACCATGCGGCTCAGCGACCCGACGAGACCCCTCTGGA
TTACTTGTACCGGCTCAACGTCGCGGGCTTGAGGGCCAACATCCCATACGCCGAGGGCACGACTGAAAAGAAGCGCGAACACGCCGAGCATTTCATCCGG
ACGGTGGACACGCAGGAGGCCGAACTCGCCTCGCGTCTCACGCTGATGGAGGTCGCCGACTCCGAGGCGCTGGAGAAGAAGCTGCGTGCCCGACAACGTG
GATTGGCTCACCAGAAAAAGACTTCCTTCGGCTCGAACAAGTTCCGCCAAAGGCGCCGACCCCGCCGACTCAGCCGGCGCGCGCCGTGCATGCGATTCAC
TTCGCGTCGGACGAGTACGACTTGGAACGCGAAAGTCGCGACAGCGACGATCGCCAGTACGACCAAGACGAGGCGGACGAAGAACGCGCCAAGTTGTTCG
TCGCGGGACAGGCCCCGCCGGAAGAGCCGGCGCGTCGTAACTTCGATCCCGACGACTCGGGACGCGACCGCCCGCGGTGCCGCCACTGTGGTTCACGTCG
CCATGTCGAAGGAGACTGCTGGAAGTTGTTGACGTGTCAGAAGTGTGGTGGCCAGCACCCGACGGAGCGATGCTTGAGGATGTGCAAGGCCTGCGGTGAC
GTGCACGAAGCCGGAGAATGCCCGATGGAGGAGTTCTTCAACCAATTGCGCCAGTGGTTTGACCCGAATAAACACGCGGGAATGCTGCCGCCGGCCGCCG
AGAAGATGTTAAACTAGGACGCTCGCTGGCTTGGAAACCAGTACGAGACGAGCGACCTGTTTTCGTCTATGCATATGTGACCAAGAAGTCGCGAGAAGTG
GTTAGTGAGAGCCCGACTTCCCTGAATGATAATACATGTGAAAACAACCCGGAACGTACCACGCAAGGACGCGCGCCGCGAATCTCGGCGGTCCGACGTA
CGACGGACGACGAGTTTGCACGTGAACCACCCCTGGACGAGATCGACTTGCAACCAGGAGAGCGACGCGGATACTGGAAACATTACGCGCCGCACAAGTG
GTACAAGCAGGCCTAGATTCATGGAAAGCTGAACAACCGCCGTGCTGTGTTATTGCTCGACACAGGTGCCGAGGTGTCCATCCTGGACACCACCTTTGCT
CGTGAGGTAGGCTGCCTGATTGACACGGAGATCACGCAAGAGTGTGTGGGAATTCGTGATGCGACATATTACACGGTGGGGAGAACCAGAGTCAAGATTA
CCTTGGCTGGGAACTTGGTGTACTACATGCACCTGTGGGTCGACGACTTGGTCGGCCAACACGCAATCCTGGGAATGAACTTCATGGTGCCCGCTGGAGT
GCGCATCGACACTGCGGATGGCGCGGCGTGCCTCCCCGACGAGGTGCATATCCAGATGATCGGACGAAGACCGCTATACGGCGCACGGATGCACCCGGTC
AACGTCAAGACGCCTGTGAGGCTCGAACCAGGAGACACGCATGAAGTCTTGCTGAGGCCGGATCGAAACGCGCCGTTCCTGTGGGTGACAAGGGCAGAGT
CGTGGGTGACTACCTTTGTCAAGGGGAGAGTCGGAAAGGAAACGTACCTGCGTGTCACGAACATCGGAGACGCAGCGATAACCCTCGACGCGCATGAAAC
GCTTGGGTGGTGGACGCCGTCTGACGGCCAGCCTCGGAACCGTGGATTCATCCGACTGGGCTCCACCCGGTACAAGCAGTGGCAGAATCTGGCGTACGGC
GCGACGCGTGACGCGGAGATGAACTGGATCCCAGTCGAGCTCGACGGACCGATGACGGATCGCCCCTCATACCCGACGCCTAAAGCCATCTTGCGCCCGG
AGTCGAGACAACTCGGGACGCGACGCGCCGTGACCCCAGTGTTGGCGGCTGTCGCGGAAGCGCCGAAGGGAAGGGGGGTAGACTTGCCACCCGACGACCA
CAAGCCGGATACGGACGAGGAGGCGGTGGAAAGCGAACCCGATATGCCTCCGACTGTGGCTGGAAGCGCTGCGATGGAATAATCGCCGGAGTCGGAACTC
GCCGAGCCAAAACTCGACGGACCAAACCCCGCCGAGCCGAATTTCGACGAGGCGAAACCTGATGAGCAGGAGGAAGACGACGCGGTCCTCATCCACGAGG
GGTCCGACCTCTTCGTAGAGGATCTCGAGTCTGAGATGGCAGTGCTGCCAGACGTCTCGCTGACCGCCGAGGTAAAGATCGAGGACTTGAAGGTCGGCAT
GCCGACTGGACTCCCGCCCGAGGAAGCCGCGAGACAAGAAACGCGGCTACGCCAAATCATCTGGAAGCGACGGAAGTGGTTGATCGGCAAAGGCAACGCC
TTGCCGACGGCCGCCCTGGGTGTTGTCTGCGACATCGACGTGGGCGACGCAAAACCCGTCGCGCAACGCGTCCGGAAAATCCCGCCGCAGTTTCGAGAGA
AGGTCGCCGACTTGATCAAAGGGCTGCTGAGCACGAGGATGATCCAGAAGTCGAAGTCGCCGTGGGCGTCGCCCATTGTCGTGATCATAAAGGAGAACGG
CGTCGATATCCGGCTTTGCATTGACTACAGGCTCATCAACGGGCTGACACAGTTGATGATTTACCCCATGCCGCTCGTCAACGACTTGCTCGAAGACTTG
GACAAGTATCTGTGGTACTGCTCCCTCGACATGGCGAGCGGCTTCTGGGTCGTCCCCATGACAGACCGGGCCCGGCTCACCTCAGCCTTCATCACGCCGA
TGGGACTGTACGAATGGCTGCGTATGCCGTTCGGCCTGTGCAACGCGCCGCAGATTTACCAACGCTTGATCGACAACGCGCTCTACGGGTTCATGAAGCT
GTCCCCGGATGGCAGCACTCGGGACGTCTTTGAAGACGGCGAACCGGTGAAGCCAGGTATTCACTCCGTTCTGGGACGGAGGTCGTACATCGACGACATC
CTCATCGGGGGCACGTCGTGGGACGACCTGTGCGAGAAGGTCGAACGCTTGCTGGATGTCTGCGAGCAGTGGCACTTGTCCATCAGTGTCGAGAAGAGCG
AGTGGGGCATGTCCAAGGTCGACTACCTGGGCCACCGAGTCTCAGGACTCGGTGTCGAGGCGAAGCCGAAGAATCTGGAGTCGCTGACGTCGCTCGAGTT
CCCGCGCACGATCAAGGGCCTGCAACCGTTCTTGGGTAGCCTCAATTACTACCACCGGTTCATTGCAGACTTTGCGGTGTATGCAACCGCGCTGTATTCG
CTGACGGAGACCGACTTCAGCGAGTACGTCACGCATCCAGAAGTCCGCGGACATGAGAAGTGGACGCACGCGACGCGCGCCTTCGACGCGCTGAAGGCAA
AACTCGCCGAGACCCCAATGTTGAAGCACTTCGACGCGAACCGAGAATCCGTCGTGATCGTGTACGCCAGCGACTGGGCCATCTCAGGGGTGCTCACGCA
GGTCCACGACGAAGTGTACATGCCTGTGAAGTTCACCAGTCGTACGTTGAAGCCCAACGAGCTGAACTACGACATCGTCGAAAAGGAGATCTTGGCCCTG
TTGCGCGTCTTAAACGAGTGCTACACGATGCTAGCAGGGAGACCGGTCCGCGTCTTGACACGTCACGCGACACTCGCCTGGTTGTTCCGGTCCAAAGGAC
TACAGGGGCGACTGTCACAGTGGGCCGCGATCCTCTCGCCGTGGAAGTTGGAAATCTGCCGATCCATGAAGGGAGAAGAAGAACTCCTCGGCGCGCTGGC
CGCGAGCATTACCCCGCGAGCCTTCGTCGACGCGGCGCTAGAAGAGATCGCCCCACGGAGACGGGCGTCCAGGATTGTAGTCATTCCAGTCCCCGACGTG
GCGCGCGACGAGGTCTTGCACGTTTTGAGATTTGACGGATCGGCCAAGGCGAAGCGAGAAGGCGGAGCATACAGTGCCGTCATTTGGCAGCTGCCGAACT
GGGAGATCGTGCGCGCCGCGTCGGGATATGCGACGGACCTCACGGTCAACGAGGCGGAATACCGCGGGCTGCTGCTCGGATGTTCTCTTCTAGAGGAGCT
TGACGACGTCACCCGACTCGTCGTATGCGGAGACTCCAACCTTGTCATCAGGCAGATGCGGGACGAGATGGACTGCAATTCCCCGGGGCTGAAGCTGCTG
CGACAAAAGACGCGAAACGCACTCCAGGCATGGCCGCGCCACGAACTCTTCCACGTACGACGAGACTGGAACGCGAGTGCCGACATGCTGGCTGGACAAG
CTCTGCAGCGTCAAGGAGGCCGCAACGCGCACAGCCCCGAAGAGATTCAAGATCTGAAGACGCTGAATCGCTTGGAAGAAGTCATCCGACCACGGGCATC
GAGTCCCGGGATGGCGTCTCCAGCCAGTCCCGACGCGGATAATCTCGACGCGGAAAACCTCGACTCGGAAAACCTCGACTCGGAAAATCGCGACGCGGAA
AATCGCGACGCGAAAACGCGCGGCGCAGATGACCCCGCCGGGAAGGCCATGGACGCGGGACGCGGGACAGCACAAGTCCTCGCTGTGACGACGCGCTCGG
CTGCCGCACGCACGACAACACGTAGGGTCCGACCTCCAGAAGTCCTGGAGGAGCTGGTGGTGCAACGACTGCGCCTGGACCGCATCCGCGTCGCTCAGGA
CGAAGAGGTCTGGATCGTCAACCTCAAGAAGTATCTCCGTGGCGACGTCGGAGACCTATCTCGGCGCGAGGTGAAGAACTTCCAAAAGCTTGCGCCTCAG
TACGAAGAGGGTGAAGGCGGGCTGCTCAACTACCAGCCGAGACGCGACGATTCCGCCGAGGATCGCGATGTGATGATGAAGCTGGTGATCCGGGAGACTC
TTCGGGAAGATGTACACCACTATCACGCGAGCCTGGAAGGCGGACACCAGGGTATTAGCCGCACGTACCAACGCGTGAGGCGCCACTTCCATTGGCCAGG
GATCTTCAGAAGCGTCCAGCGCTACGTCGGCGAATGCACCGACTGCGAGACGGGAAAGGGTCGGCCGACCATCCAGGGCGAGTCGCCGGGCAACATCGTC
GCGACGTACCCGTTCCAGGTCATTGCCATGGACCATATTCCGTCGTTGCCGGCATCCTACAAAGGCAACACAGAGCTGTTAGTCTGGGTCGACCTCTTCA
CGGGGTTCGTCGTGGTCAAAGCGAATGCGTCACGAACCGCGCAGACGGTGGCCGAGGCGTACGAGGAGGCGGTGTTCAGGCGCTTCGGCGCGAGCGAGGC
TATCCGCCACGACCGCGAGCCGGGCTTCATGTCCGACTTCTTCAAGGCGTTCAGCAAACTCATGGGTCAGAGACAGCGAGCGACGCTTGCTTATCGTCCC
CAAGCCAACGGTGCTGCAGAACGGATGGTGCAGACGGTTACAAGAGCGATCAAGATGTACATCGCAGACGTCGACCAACGCGACTGGGACGAATACGCCG
AGCGTCTTACCTTCGCGCTAAACACGTCGCACGACCGGACGAGGAATGAAACCCCGTTCTTCTTAGTGCACGGCTGGGATCCTCGGTCGACGCTGGAAGC
GACGCTGGCCGTCGGGAACACGTCGACCCGGGACGCCGAGGCGAGGCGGTGGAGGCTCCGTATTCAGCGACACTACAAGGTGACAAGGGCACAAGCGTTG
GAGTTAGTCCGAGAGGCCGTCGACGAGAGAGCGCGTCGACAAACTGAAAACGCGACGCGACATGAGATCGCGACGGGCTCGCAAGTTTGGCTGTACCTGG
ATCGGGTGAAGCCGGGGTATGCGCGCAAACTCGCGCACATGTGGCACGGACCCTTCCGCGTCGCCGAGCTGGTCAGCGCGTTCGCAGTGCGCCTCGAGAC
GACGGGTACGCCCTATCAGCTGTACCCCGTCGTCCACATCTCCAAGCTGAAGCCCGTCCGGGAATTCCCGTCGCGACCCGCGACGCAGCTGACGGTGCCG
GCCGAGGAGCGCTTCGACTTCGACGAGGAGCTCTTGCCCGAGGATAGCTGGGAAGCCACGCGCGAGCTGGAGGACGACGTCTTCGAGGTCGAGAAGATCG
TGAATGTGCGCGAGGGGCGGGCTACCCGGTATGGGCGCACGCGACGCGAGTTCGAAGTCAAATGGAAAGGCTACCCGGACACAACGTGGGTCGACGAGCT
CGATCTGAATTGCGGCGGGTTGCTGTACGACTTCCTGCGCCAGCGCACGGGACGCAACCGGTTCGAGGCGATGCAGTCGCACGAGAATGCGGAGGCGGTG
GAGCCTGGTGGGTGAGCGCCCACGGGTGCGACTAAGTCGGCGGGGGGGCTGCCGACGGGAGGACTGGTGGGAAGCCTCGACTCTGGGAATGGCCGGAGCG
AGGGATTGGATGAGGGAAGTGAGGAGGACCAGCCTGTTGCTGAAGATGGGACGGCGGAGGGCCGTCTCATAAAAGATGTGGAGAAGTGGAAAGAAACAAG
GGAAAAGATCAAGGCTACGTGTTGAAGTTACGGCTACAACAACTAAACGCAACGGACTGCAACGATGGGCCAAGACTCAAACCTGCTGGACAAACTTACC
TGCAAGACGCGGCACATGGAAGGCTGGGTGATCGCGCGTCACTCGGCAGCGTACGTTGGCGTCCATCTCGGCCACAGTGAGCGGCGTCCGATAGAACCGG
CGCCAGGACTCCTGCGCGTCGATGTCGCCGAGCGCGGCTTGCAACGTCGTGTGCTGGAGGCCTGGATACCACCGTCCGATCGACGTGTGCGCGGACGGAA
AGTGAAGCACCATTGGGTCCAGCAAGAGGTCCATGTC