Description :
From Genome Similarity Track
Location :
Scaffold_70:23987- 27343
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_70-fgenesh-gene-0.15Tigger transposable element derived 6
Pytir_DAOMBR486maker-pir_contig_70-fgenesh-gene-0.7Ribonuclease P 40kDa subunit

Sequence
3356 bases(100 bases per row)
CTTGTTGAGCTGGACGACGGCATCCACGCGGTTCGGGATCACGTCTCTCGACAGGCGCAGGTACTTCTTGAGCGTCTCGATCGACGCCAGCACTTCTTCG
TGACGAGGGCACTGGTCCTCCGCGACGTCGTCCTGGGACTCAAAGTGGCCCGCCGCGTGGGTCGCGTCGTCGAGCTTCTTCGTGGACAGACAGTCGTGCT
TCTGCAGCACACTGCGGATGATCTGCACTTCGTCGATGCCCGGGTCTGTCACGGACGCGTTGCCTTCCATCTCGGCGAACGCCTGCGCGTTGAGCGGGTC
TGCCACACCGATCCAGTGCAGAAAGTCCGGCGCCACGTGGGTCACTTCTGTCATCAACATCTGCAGGTCCCGGTAGATGGACATGAGGTTCGGGAGCCCC
GCCGCGTTGGTAGCCGGGAGCGCGTTCGTGCCATTGCCAGTCGGGCTCGACGACATGATCTCCTTCATGTTGAGCGTCGCGAGCGCCTGGGTCGGCAGCA
AGCCGCTGTGCACCCAGCAGTTCTGGATCATGTTCTTGTCGAGACTGTGCAGCGCGATGTAGAACCAGTGGAAGACGTTGCGTGTGTGCAAGTGGCGCAT
CGGGTGGAAGCTGTGCAGGTCCTGGTTCAACAGGCACTGGCGGTAGTTGGAGAACAGCATCTCGATCATCTCGTACCGGAAGCGCGCTTTGAACGCCTGG
ATGATGCCGAGGTGGCACGGGTGGAAGCGTGGCGGCTTGAAGTTAGGCGGCAAAAAGTAGATCTGCAGGTGGTCGTACAGGAAGAACGTGCGCTGGTCGC
CCTGCGAGTCAAGGATCATCGCCGCCTTGACGTGCGGCACGGCGCTATCCAGGATCACACGGAACGTGCGCTTGCGCGACTTGGCGAGCGCGTTTAGCGA
CTTGAGCATCGTTACGGTTGTGTGCGCCACCTGCCAGCCGGTCTTCGAGTGGCCGTACTGGATGTTGTACGTCTGCTGCGGGTTGATCCCCTCGAGCAAC
AGCGGGTTGCGGTCCACGCCGATCACCTGCATGTCAAACTTCTCACCCGCCGCGCTCACAAAGAGCGACACCGTGTACCTCCCGTTGCCCGATGGGTCGC
CAGCGGAGGGCGGCGGCGCGTTCGGGTTCTGATTCGCGGCGTTGGGCTTGTACACAACCGCAAACTCGCTGCCCGTCCAGATGTCCTGGAGGTCCACTTG
ACTCAGACTGTGGTGCAGTTCTCTCAATCGCGTCTGGATGTCGACGTTCTTGATCACGTTCTGGTCACCCTGCAGCACTTTCGAGCTGAACGAGCCGAAA
CGCGTGCGGTACCCGTCGAGCCATCCGTTCGACGCCGTGAACTTGGTGAGCGCGATGCGCACTTTCTCCGGCAGGTCCGCGTACGGCTCTTGCAGGATCT
TGAGCGCGAGGTCCATGGCTTTCTGCTGGAGCACCGTGCCCGTGATCTTCTGGTCCGGACTGCTCACCTTCACCTCCATGCGCCACTTGTGCAGACACTC
GTCCAGCATGCGCAGGTCGTACGTACACTTGGTGGTCTTGCGTTTCTTCTTGGCCGCGTCCGCCGAGTCTGTCTCGGTGCGGATGAGTTCCTCCTGGCGG
CAGATGTTCGTGATCGTTGTGCGGCCAACGTTGAACTGCTCCGCCAGCTCGCGGTGCGTGAACTTCTTGCTGGCAGCCAGGTCCACGACCTCGCGCTTCT
GTCCGAGAGTGAGTCGCATGCGACGTCCTGCTTGCGGCAACCCAGTGCCGTTCAAAGGCGACTCCGACGTGCTGCCACCCTCCCCTTGAGTGCTTCTAAG
CGCGTCATCACCACCGCCACCATCTTCTTCCTCCTCTTCTTCTTCTTCTTCTTCTTCTTCTTCATCGTTCTCTGCCGAGTGCTCGTCGAGTTTCGCCTGC
AGCTCGCTCATCATGCTGTTCGTGGCGCTCCCGGTCACCACCGCATGCACGTTCATGGCCGCCACCGCGGCTGCTGTAGTTGCGTCATTTCCGATGCCAT
TCTGCGCCATCAGCATCTGCATCTGAAGCTGCTGCTGTTGCTGCGCTTGGAGCTGCTGAAAGCCATTCGCCGTCACAGTTGCAGTCGCAGTCGTCACAGT
CGCCGTCGCTGTCGCCGTCGCCACCGTTGAGCGCGCATGTTTCCGTCCAATGTGTAAGTTGCCGCGATTGAGCTGCTGGTGGTGGTGCAGATCCATCTCC
ATGCTCGCGGCAGGTGGTGCTGGCGCATTAGTGGCCGCATTATTGCTGTTCATCCTGATTGAGTTGGCGCCAAGTTTTCAAGTCGCGGTCTCTCATTTGA
GATTTCTCCCTCCCTAACCGTAGAAAAACGTTCTTATCTCCAGTGATCCAGTGATCCGAACCTCTTCAACTTGTTATTATATAAAGCAGGAATTAGTCCA
ATTTGATTTACTAAGTACGAAATCAATCCCTTCGATAAAGTACGAAGCGTCTCACACAAAACTCGAAGCGGCAAAACCATTTTAGCATCAGTTCTGCCAG
GAACAAGAGGAATGGTGAGTGGCGGCAAGAAGCGCGTGAAGGACCAGCGCCACAGCGCCGGCAGCGGCCCGCAGCCCGGCGCGCAGCAGCCNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNCTCGTCGCTGCGCCTGGACAAGTCGCGCCACCTGGAGATTCTCGACGGCCATGCGCTCAGCCAGCAGCTGGAGC
TCTGCGTGCCTGGGAAGCAAGGCGTGGAGCTCGCGCAGTCGCTTAAGTGGGAGACGAGCTTCTTCTACGAGATCACGGCATCCCTCGCGATGCTGCTGTC
CAGGCGCTTCATCAAAGAGTACGTGCTGCAGGGCTCGGTGTACATGATCGCGAAGAACGTGCCGGTAGACTCGAGCAACTCAGCGATGCTGCTTTCCACT
GGGGAGCTCCTGCTGCTCGTGGACGCTGCCACGTACGAACAGCTCGGACTCGTCGGCAAGAAGTACGGGAAGGCGATCCCCACAGAGTGCAGAGGCGCTG
CCACGTACGCGCGACAGAGCCAGCGGTATGTGATTGCGTTGAACCTCAAGTCTAAGGCGTTCACGTCAGACGAGGACTCGAGCTTCCGTAATCGCGTGGT
ACACTGCCTGGAGACCAAGTTCGCGCCGCTCGAGATGCTCGTGTGCGCGTACAACGAGCGTGGATCTGCGCGCACGATCACCTTTGCTGATGACGACTCG
CTGGAGCGCAAGCGTGTTGAGGTGAATGGTGAATGGACCCACTTGCAGGACCTCATGCTCCCGCAGTTTGACAAGTTCTATAGCAGCGTATTGAAAGCAA
CAGATGATTCGGATACTTCGACAACTAGCACTCGCGATGAGCTCCTTGCGTCTCTA