Description :
From Genome Similarity Track
Location :
Scaffold_3:2398430- 2400101
Transcript NameFunction/comments
Phyin_T30-4PITG_22706M96 mating-specific protein%2C putative
Phyin_T30-4PITG_02519M96 mating-specific protein%2C putative

Sequence
1671 bases(100 bases per row)
ATGACTACAACGACGACTACTACGGCCACGGCAAAAACTACTACAGCTATGACAAGGGATACGGCAAGAAGGACTACGACTACTACCCTGACTACTACTC
GTCGTACAGCGGTGGCTATGGTTATGATGGCTACTATAACAACGGATACTATCCCGATTCCTACTCGTCCTATGGCTACGGTGACAAAAATGGCTATGGA
TACTACCCTGATTACTACTCGTCCTATGGCTACCCTAGCTATGGTTACGGCTACGATCACGGCAACAGCTACGGCTATGGCAACCCCTCCTACGGTTTCG
GATCCCCGGGATTCTTCGACTACGAGTCTGCTGCATCGGACGCTGGCACGGACAGCACTCCGAAGGAGCAGGGCTCGGACGCGGCCAAGAGTAAGTCGGA
GAAGAAGGAAGACAAGCCCAACGTTGAGAAGAAGGAAAACAAGTCGAATGCCGCGAACAAGTCGAAGGGCAAATAAAGACGTGATCAGAGAAACATGAAG
CGTGTGCAATACGTAGCGTTGGAAAGCAGAGGTAACACTAGAAAATACAATGCCAATTAATGTGACGTGGTAAATGGTTTGAGTTTAGTTCGGACTCGTC
CGTACAAATGGATTAAGTATTGCGTTCGGTTGAGGAACCGCGGACTCCTGTAAGATTTAATGACGTCTTTTTTTTATCCAAGTATCCAAATCCGAAGGTT
CAAACTCCCGCTTATGATGAGCGTTGGATATCATTTTTAGTACTGTAAACAACAACTGTGAGTCACAAAGTTATGATAGAATGAAGTTGCGAGAATCGTG
TTGAATGCCTCAGTCTAAGTAGTCATGACAGAGAAGACCTCTTTGAGGTGACGGCGATAGATCCGAAGCGTTGTGCTCTCTCCTCAGCGTGTTGCCGCTC
TCTCACTTTTCCTTTCGCCTTCTTTTTTGCACTCTTGACCACCGCCCTACCAGCACCACCGTCAAACAACCAAGAAACATCGCGTTCAAGATGCATTCCA
AGATCATCCTGTTGCTCGGTGTTTGTGTCGCTGCCTCCATACTGCAGACGGCTGACGCGCGCACTACCGGGCGCCACCCTCGTAAGCACGATCATGGGCA
TAGGCAGCACCACGGCCACGACCACCACAAAGACCATTCGCACTATAGTCGCCGCTTAGAAGACAAGGACAACAAGGACGACAAGGTCACGGAGTCATCC
AAGTACACCAGTAGCTACGGCAAATACGATTATGGCCGCGACGACTATGGCCACGACGACTATGGCGACTACGACTATGGTCACGACGATTATGGTCACG
ATGACTACAAACGGAAGGGCTACGGCTACGACGACCATGACTACAAGGGCTATGGCGTTGGCTACAGCTACGGCTACAAGAGCTATGGCAAGGACTACGA
TGACTACAACGACGACTACTACGGCCATGGCAAAAACTACTACAGCTATGACAAGGGATACGGCAAGAAGGACTACGACTACTACCCTGACTACTACTCG
TCGTACAGCGGTGGCTATGGTTATGATGGCTACTATAACAACGGATACTATCCCGATTCCTACTCGTCCTATGGCTACGGTGACAAAAATGGCTATGGAT
ACTACCCAGATTACTACTCGTCCTATGGCTACCCTAGCTATGGTTACGGCTACAGCCACGGCAACAGCTAC