Description :
From Genome Similarity Track
Location :
Scaffold_6:2398333- 2399907
Transcript NameFunction/comments
Phyin_T30-4PITG_04729Putative uncharacterized protein

Sequence
1574 bases(100 bases per row)
TTATGGTCATCTGCATCTATTTTTGCATCAAAAATGGCAATTCGGATTCTACTTGTCCTTCAGGTAACTGGACTCGTCAGCTGGCCATAACGCTCCCCAA
TGTGCCTTCCGCGACGCACGATACACCTCACGAACTGCTTTACCTCTGGTTACACTACGACGCTCATGCTTTCCCTACAAAATTATTACAAAACCTCGTT
AGAAACTCAATTTCAGCAGTACAAACTGAGCTACAGGTAATGCACCATACCTCCGGAGTGCACAGGTCAAGATGCACGTGGCGGGTAGCAAGCAGTGGGT
CTAGAAGCAAGCGTGCAATCGGTTTCTTCTTCTTCGCGGCGGCATCTTCCTCAATTCCTTTGCGTGTCTTCTGCATGATCATGTACGAGAACTTGGAGCC
CTTCTGCCCATGCCAGCGCTTAGTAGTCACTTCACGAGGGCGATTCACTACAGGCGAGCGCTGCACAAAGTGACACCACGTGTTTCCACCTACTGGACAC
TGTCAACAGCACAAGCAATACGTTTTAAACACCAACAAGGACACATATCCAGCTGCTTCACCTTCCTACCTCATCATGATGCGGGCACGGGGCCACAATG
CGCACACCTTCCTTGCCATCTGCATCCTCAGCAACCAAGTCCAGCACAAACTGACGCGCGGATCGCACGTGATGCGACCCCCACGGACTACCACGATCTA
CAATCACCAGACACCCGTCCTCGCTCAGCAGCTCCCATAGTGCTGAGGTGGTCGCGACACGCTCGAAGTCGTTCGTGATATCTGAAAACACGTAGCTCAC
CACTACGAGGTCGTATTTGTTGCCAGCATCGATGTCTCTGGACAAGTCGGTGATATTGCGACGCATACTCAAGCCTGGAAATCCCTCGAGCACGACCTCA
GCCGCGTCCACCATAGACTGGCTGGGCTCCACCACGCGATATTTATCCAGTGATTGGTCATAGAAATCTTTGGCCACCCAAGATGCCGTACCGGGTCCTG
AACCGAAGTCCAGCACGGACTTAGGCTTGAAGTCGGGTAGTCGTTTCTGCAGCTCCGTGAATACAGCGTGTGTGCAGGCGTAAGTGGCCTCCATCTCGTA
GGCCAGGAAGGCCAGCGTTTCGGCCGGTCCGTAGGCAAAGGGCGGGATCTGCTGGCTGCGGTCCATGGTCCAGCCCAGAGGTGTCTTGCTCATGTCAAGT
GGCACCTGTCGCGTATTCCGGCGGTCACCTACGTGCTTCTGGCGTAGCATCTCGAGCTGCGAGTGCGTGCGGCTGCGTACGACGGATGCAAGACGCTCCA
ACAGCCCCGTTGGCATCTCCACACGCCGCGCTAGGCCGTTTCGCGAGAGCTCATTAATGTCCGCCAAAATGGAAGGAGTTCGCGGGTCTGTAGACGAATT
ATCAGCCGCTTTGGCGCTAGTTTTGGATCTACGCAAGCGTCGTGCGCGACGGCTAGCGGCTGGTGAAGAGAAACTGGCTGAAAGCATTGGAGCAGCGGCG
GCCGGCGCGAGGCGAGCGCTCAGCTTCCGCAGCATCGTCAGTCGCGACAACATGAATGCGAATCGATGGTGGCG