Description :
From Genome Similarity Track
Location :
scaffold_18:239833- 241029
Sequence
1196 bases(100 bases per row)
CCATTACATGTTAAATCATATATATGTGACGCTTCTGTGTTTGCAATTGGCTGCACATTATTGCAAGGAGACCCGAAAAGACTTAATCGTTTCGTTTCAG
TCGCGACAGCTGAACCCAGCAAGAAAGGACTACGCTGTTCAAgtcaagaagctttgacaatGAACTATGCTCCAGTAAAGTTTCTTGTTCACCTTTTGAG
TTCAACTCCGTTTGTCGTCTACACAGATTACGCAAGCTTGCATCATGCAGTCCAGTCGCCTAACTTGTCACAGGAAATGGCTCGCTGGTCGTCATATTTT
TCAGAATACAACTACACAGTCGCGTACAAGCCTGGGGAATCAAACGTGTTGGCAGAcgcattgtcacgtcgtcctAGTTATGagtttgctcatgtcactT
TTGTCTAGGGTAATGTACTCGatatgatacgtcgagcGTATGTTAAGGATGAACAGTGTGATCTGGTCATCAGAGCACTGCCATCGAGCGAAATGGCATT
CCATGACAAGTTTTCTGGTCGCTTGAAGATATGATTTGCATCAAAGGATGACGTTTTTCGATATGAATTTGCATGGTCCAACAGCCCAGCCTTTCTGATT
TGCCTATGGCCGGTCGCTTCGACCGTAAGAAGATCTACCAGCTACTTAGTGTACGAATGGGTTGCACGATACGTTAACGGAGAAAGCAGAACGCAATTTT
CGCTGTAAAGTCTTCCTGTCCCTACTGACTACTAAAAGTCAGTCAGTCTTGATTTCATTCCTGGCTTCCCTGAAAATGCTGACGGCCACAATGGGATTCT
CGTCTTTGTTGCAGACTCTACAAGATGATTCGCAGATGTTTCGCACCGCTCCGCGCAGCGATATCCATCGATGCCAAAGGTTTGGTTGCATTGTTTATTG
ATCACGTTATACGCAATCATCGTCTCTGATCGATATACGCGATTCACTAGGGGCTTTTGGAAAGTACTGCTTCGAATTCTTGATTACCGCTTGATTTTGT
CCACAGCGGTACACCCAGAGACTGATGGGTAAACAGAACGAGCCAACTGAGTATTCGGTGATGTGTTGTGAAGCTTCTATGCGAAAGGTCCCGCAGAATG
GGGATCGTTGTTATCATTGGTTGAGTCTACTATGAACAACTCAGTTCATTAATCCACTGAATCCGCGCCTATTTTTAAGAATGGCTTACGAAACCC