Description :
From Genome Similarity Track
Location :
Scaffold_406:2398- 3752
Transcript NameFunction/comments
Phyag_g5433hypothetical protein PHYSODRAFT_491072

Sequence
1354 bases(100 bases per row)
AAGGTCGGCAAGCAAGGCGCCATCGTGCTGCTATGCTGCATCAACCTGCTCAACTACATCGACCGCGGCATCATCCCCGGGGCCCCCGAGAAGTTCAACC
AGTTCATCACCGACACGTTGGGCGTGAGTGTGCTGCGTCAATCCGTGTACTTCGGTCTGCTCACGTCGGCCTTCATCGCCAGTTACTCCattttctccat
cgtcttcggcTACTTTGCACTCACGCACCGACCATTCCGCATCATTGCGTTGGGTATGACTGTGTGGGTGGTGGCTGTGGTCATCTGTGGTATCGCGCAG
GCGACTGAGAGCTACTACGTCCTGATTATCGGTCGTCTTATTAGCGGTGTCGGTGAAGCTTCGTTCCAGTGCACAGCCACGCCCTTTATCAACCGCTACG
CGCCGCCTGCCAAACGTTCGCTCTACTTGGGCATCTACCTGGCCTCCATTACGGTGGGCACTGCTGTCGGCTACATCTACGGGTCCATCTTTGCCAGCTC
CGGATTCGGCTGGGCCGGAGCCTACTACCTGGAGGGTATTCTCATGATCGGATTCGTGGTTGCCTGTCTGGTGATTGTACCGGACGAACTAAACCAGATC
CCCatcaagcagctcgacacTGACGAGCTGGAGTCCAAGCACGGgagtgtggtggtggctacTCCAGAGGACGCTGAGAAGGCGAGCGCGACTGCATTCC
TGGAAGACAAAGACCGCAACATGGCCAAACCGTCGTTCATTGCGGAGTGGTGGGGTATCTTCAGCAACCTGCCGTTCATACTGATCATCGTCGGACACGC
CGCGTACACGTTCTCGTTGGCTGCCATGAGCACCTTCAGCCCTGCTATCTTCATTGGCTTGGGGTTGTTCGAAAGCGAGACGACGGTGTCGCTTATCTTC
GGTGGCCTAGTGGCTATCACCGGTACTATTGGTACGCCTTTGGGAGGCATGCTGGTCGACTACCTCGCAAAGAAGAAACCAGAGGAGATTGGTCGTCGCT
GTGTGATCTCCGTGCAGGCATTGTTCTACTTCATGCTCGCTGCGGTTGTCTTCGGACTTgtgatggtggcgttcgccagcaccaagaTGATCTGCCTGGT
CTTCCTTACGCTCtgcctcttcttcatgtgcGCGCTGTCGGTGCCCGAGACGATTGCCgtgctcgagctcttcccCAAGTCTCGCCAGTCCATGGCCGTT
GCTGCCAACACGCTGATCATCCACGCGCTCGGAGATGTGCCGTCCCCGATCATCCTGGGTGCTATCAAGGACGCGTGGGCTCCCCACTGTGGCACGGTGG
AGATTGACGGTGAGGCGAAGCTTAACCCGCGCTGTTCCGAGGACCACTCCGGTC