Description :
From Genome Similarity Track
Location :
Scaffold_1128:2398- 3527
Transcript NameFunction/comments
Phyke_g11553hypothetical protein

Sequence
1129 bases(100 bases per row)
GCTCGATTCAATGATCAGCTCACGAGCTGACTGGATCCCTGGTTACCGTCATCGAAGTCGGTATACACCAGCAGAAGTAACTCCATGGCCTCTGCCCGAC
GTTATGATCACCAGCGTCCGCGAGCTGACCGTCAACACACTTTTCCACCAGTTCAGCAAACCTCCTAACTGGATGTTTCCTTTACGATCTCGGGCACCAC
CGCGATCAACCTGGTCTCCTGATCTCATCACAGAGGCCAACGTACGAAGCATACTTGCAACTCTCCCCTGGCAGGTGTTGGAGTCGGTTATCGTGCCTCG
GTCGTTTGATCTCTCGGGCTGGTTCGACCAGCTATCCCACAATTATCTACAACTGGAGGACGAATATCGCCAAGCTTATTGGGAAGCAACCCACGCTCTC
CCGATCACGGCTGATCAGCAAAGAAGCAATGCTTATCTGGCCGCGTATTATTTAGAACGCAAGCAGCGTCGATCGCGAGCCGGTGCTCGTTGGAAAACTC
TGCTTCGATTCATTCTGCAAGGAATGATCGCCGGACACTGCGATCTCGATATTCTGCTGGACCCGTTCTTCTTGCATTTTCCACGCCAAGGTGACCACGG
AATCTGGTATCCTGGACTCGGAACTAGTCCGGCGCCAGCAGACCTGattgctgcgcttcaagctgtcgATGTTGGTGAGCCATGGCGCAACCACTTTCGT
GATCGACCCGCTGACCATCCAGCACTCTGCATCGCTTGCTTAGACGGGAAATTCCGGCCTCAGACAGATAGCGATTAAGGTACAGCTAGTAAATAGCTTC
TTGCATATTCCATAACGTCTGCAAtcagccaccacttgcttcTTGGTCGACTCTGTTGAGTCTCCTTTTCCTTCGTATCTTATGTAAACTTAAATCGAGA
GGTGATTACGTCCTCTCGATTTAACAACTCACTTCACATGTACATCCCCCACATAATGTGCAGCCTCCCTGCACATCTTCCACTCCACTTTCCCTCAACA
GCCATCCTGCTACGGGCACCTACAGATCCTCTTCGTGAGACTGCATCACGTTGAAACGGCTTCGACTCGCGATCTCCCGTTCATATTCCCGTAATAACGC
ACCACAATTTAGATCAGCTTCGTCTAACC