Description :
From Genome Similarity Track
Location :
Scaffold_27:239796- 241483
Transcript NameFunction/comments
Sapdi_VS20SDRG_08761hypothetical protein
Sapdi_VS20SDRG_08762hypothetical protein

Sequence
1687 bases(100 bases per row)
GAAAGATCCACGCCCACGTCTCGGCATTCGTCACAACCTTGGTGCGCCAACGACAGGACGACGACGCGGCAGCCAGTGTGACGAACGCACCGCCGGCCAA
GCGCCTTCGGTCTTGAGTCCTAACATCGCCATACTATAGTTTCACTGACGTTCATCAAACGACTCGAGAGTACAGATGGGCTGCATGTATCAAGAACGTC
GACGACAAGACACGACGATCGTCGATTGCCCGACGGCACGAGCGTTGGCGTCGTACCCGCTGGAGATGGTCGACGTCTTGTTTTCGCAAAAAGCCTTGCA
TCCTGACTGGTGCAACTGCGTGGCCCGCGTATACATCGTTGCATGCTTGTGACGACCTCTTCGAAGGCCCTTGTCGGCGGTCGGCATGCCAGCTTGATGG
GAACGTGACACTTCCCTTTTGCACGGAACCGGCAATGCCAATCGATACCTCTGTTGTACGGGGGATAGCGATAAAACTGTCAGCGGCGGGATGTGAACCC
GCGAGTGCGAACACACTAGAACTTGAGTCTAGCACCTTGGACCGCTCGGTCACAAGGACTTTGCCATACTACATGACTATTCCCATATTCTTTAGATGGA
AATTCGAATAAAATGAAGACACTAAATGCAAACAATAACCACAACATTGGACGTGGGCATGTAGTGTACCCGAAGAGAGCTCTCCTCACTCGCGCCAATG
TCGTTTAGCACCCGAACAACCCAGTGAGACAGCATTACGAGCAGGGTACCTTCCAGGCACGGCGTTATCCGGATATCTCCGGATAATTTATGTACAGTAC
ATGTACTAGAAACCGGAAAATAATGCAGCGCTGGATAAGCAGCTTGATACAATGAAAAAAGCATTGCACTCGGGCGCCTGGAACAGCAGGTGCCCCACAA
GATTATTGATACCTTGATACTCCAGAACATCACGCTGCAAGGGCGAACATCCGGATATGTATCCGGTCGACTAAAATCACCCAAATGAGTCTTTCTGACT
GGCTCCTGCAGGGTCGTGGAACAAGACAGCGCCGCTTCTCGTGGATTTTGGAACGTGAAGAAAAGAATTCTGCAAACGAATGGCACGGTGTTATCAGCGA
ATGAAACATCAAGCTTGACCGTTTCCGGATAATAATTACCTTTTCTGGCTATTTATTTATTGCACTCTTAACAGCCGAGTGCAGCGACTCGTCGTCTCGC
GCCCATTTTTGCCACTGAGCCACAAGTTTCTCCAAGGTACCATCCGCAACACGTATACACTTGACGATCACCACTGGTGATTTCACTATCTTGAATGGCT
TCGCACCCCCGATATTCGTATTTATTCCGTTATTATTCCTTACAAGGCGGACTCTGCCCATTCGCTCCGACCACCTCAGAGAAGCTCCCTTGGCAAATTT
GTCTCTTGGCAAATTTGTCTCTTGGCAAATTTGTCTCGCACAGGTGCTTTGCTCGTCGCCGAAATCCATAGGTTGAAACAACTTGATTGGTTGCGTGCAA
CTAGACTATCAACCTGCTGCAAGTTGAAGCAGGTGCCCTACATGATCAGTGTGCAAACGACTCGACCATGCATCCAACGACCTCTGCGCTCTGCGACCGC
CTCCTCTACAGCTCGGACGACGACAGCGACGACCATTTGACGACTGTCGCCACCAAGTCGCTCGGCGAACTGCTAGAGATTCCGCTC