Description :
From Genome Similarity Track
Location :
Scaffold_407:2397- 3453
Transcript NameFunction/comments
Albla_Nc1412889060S ribosomal protein L6 putative

Sequence
1056 bases(100 bases per row)
ATCTAAAATTTCATCTCGTGCACGATATCTTTCTTTGTGAGAGAGAATTTTGCATTCAGATAAGCTTTTAAGAGCGGTTCCGCCTCAATCTGATTGATGA
GCACTTCGTCCACTGCTTTCTGATCCTTTCTCCGTTGATCGCTGATGACAGGAGCCTACAACACAAAAAGCGTCAGCTTGAGTTGGGAACTTTATCACAG
CGATTCCAAGCGCCGATAGAATGATGAGCACTCGGGCGCTAGTATCAAGCGCCACTAGAATTGGAAGCTATTTTACGCACCGAAGTCGATTGCTCAAAGA
ATTGATCTTCTTTGGAGCTTTTCTTCTTCACTTTCTCCTTTGCAAAGTACGAATCATCAATGTCGATGGATGGAACTCCCGAAATGTCAATTTTGGTCGA
AGTGGCGATCACATACGCTTGATTGACTCGTCGCAAAGGAACACCATTGATCTTGTAAGGACCTATATACCCATCATACAGTCAGTATCAACTCGTTGAT
CTTGTGAATTCTCAGCTCTCATAATCTTGCATATCTTTGGCAGAAAAAAGCCTACAGCGCAACTCACACTTTACCCACACTGAACAAAAGAACAGGTCGA
AAAAGCGCTCGCCGCTTCCAATCGAATGTATAGAGACACAAGTCTCACACAAACGACTGACGTAAGCTGTTGACCACCTCTCGTTGTCAGTTTGCATCAT
CGAATTCCGTCTTCACACAGAAATGACGTACCAGTAACCAGTAGAGTTCCCGACGGAAGCTGCTTCAAGAAGACGACACGTTTGCCACGAAAGCGACCGG
ACAACAGGATCAATACAGTTCCTGGCGTGATGGATTTACGCAATACAGCGGTCTTCTTACTGTTTCGTACAGTTTTTGCGGACGCGAGTCGCTTTGGAAT
ATAATCCGCCGGGTACCATTTCTTCTTGTTGGGACGTGTTTTAGGCGCAGCAACCTTCTTTTCTGCCTTCTTCTTAGCGAATTGGAATCGACCATTTGTA
CGTGCCAATGAGTTGGATGAAATGGCGTTAATTCCGCGTGCAAGCACAATGTTTTG