Description :
From Genome Similarity Track
Location :
Scaffold_10:239693- 242787
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G004695Protein of unknown function
Pytul_DAOMBR144PYU1_G004694Similar to 73: Immediate-early protein (Saimiriine herpesvirus 2 (strain 11))
Pytul_DAOMBR144PYU1_G004693Protein of unknown function

Sequence
3094 bases(100 bases per row)
GCTGCCGCCACAAGGGCAACCGCAAGCTTTTTTTGCAAGCAGACCACGCCAGCTTCCTCAAGGGGCTCAAATGGATGCTCACAGACTGCTCCGAGGACAT
GGCGCGCTTTGCGGTGTTCATTATGCAGCAGTTCGCCAAGGACTGTGCGGACGGCGGGGAGAGTAGTGTGTCCTCGTTCTTTGTCTCCCCCTTTGACAAG
AGCTCGTTCGCGCTCCTGCTCGACCAGTTGCTCGACCGCCAGCGCGACGCGCCGTGCGGCAAGTTCACGTCGGCCATGATCGAGCAGGTGCAGGAGAGCT
GGGTGTTTGCCTAAAACTCCGCGGTCTTCCACCCAATCTCCTTAATTATTTGCGCTGGGAACACAAAGAGTCAATGGCAAAGTATACTATCCGCGACGTC
CCGTACACTAGAAAGACACTATTCGACTTGTGCGCTCCTTATTATATTTGAAAAGTCCCCAAAGCACACGCCGCCATTCGCCGCCGCTCTTCGATGGCGA
GTTTTTGAGGCGCTTCAGACTAGTTTCCGTATTTCCATTAACTCATAGAGCCCCTCGACACGTTCGAATATACATTATCCAATCCAATTGGCTGTTTGCA
TCCACTTTCGGATTACGGAAGTCTCACTGGGATGCTCATCTTTGGTTCTTCGCAACCTTCACTCACTCGCAGCTTCTAATGCAACGCCTGCACGCAAAGT
CACATGACGAGAGCTCTTCGCTGTTCTTTGTCCATAAAGAAAATGCAACTCTCTGCATGGAAATGGCGGCACAGCGCTCTGCTCCGTGTGGTTTCAGTGT
GTGTGTGTATTGCTTTTTGTGTGTGTGTGTGTGTCGAGTGTGCCTATGTATGATATTCGTCTACCGCTCTGTGTCTCACAACAACGTCAGCAAGCCGCCT
TCTCCTTTTTCTCTAGTTTTCGAGGCCGCTGAAGAAGCTCGGACGACGCACCCATGTGCGCGGCAGCGTCTCGCTATCGGTCGCTAAGCGCAGCGTCTTG
TCCTCGGCACGCATGTACAATGGCTTCTTCTTCTTCGAGATGTCCTTGACCGCGATCTTCCACTTACCCGTCACATCCGTTGGCTTGGCGAAACTCTTGA
GTTCCTCCACCTTGTTGTTCACCGCGAGCTTCTGCAGAGTCAGCGCCTCCTCCGGGAACAGCTTGTCGGTCGAGCCGTGCTTGCCCAGTCGTCGTACCAG
CGGCGGGTACCCTTCAAACTCGTCGTTCAAGAAGAAGAAGTCCGGGTTGCGGTACGCGTCCTCGTCGATGCCCATCAAGAGCGCTTCGTCGTGCGCACTC
AGCTCCTCATTCTCCTCTTGGTCCAACGACTGACGCTCACGCTTCTGTAGACGACGCACCTCCTTCTCGTCGCCAGCAGCCTCGGCGCGAGCGAGGTGCG
CGGCTTCCTCGTCCATGCGCGCCTGCGCAGCCTCCTTCGCGGCCTTGATCTTGAGCTCAAACTCCTCTGGCGTCAGACCCGCTTCCTCGCCCTTCAGGTA
AATAATCGCTTCCACACGAGGCTTCGTGAGGTGGAACTTGCGCGCGAGCTTCTCAGACGTCCATTTCACCGGGTTCTCCATGAACAACTGCATCACTTCT
TCGTCCGTCTCCTCGCAAATGTCGACACCGCCTTCGTTGATGTCGGCCTCTTCGTCGAGTTTCAGGTCGCCGTCCTCGTCTTCGCCCTCGGCCTTCTCGG
CGTCAGCCCCTTCACCGTCCTCTCCGTCGGCAGTGCCACCTTCGGCGCCGTCTTCGCCCGTAGACGCCTTCTTGTCATCGTCAGCGAGGCTCAAAAAGCG
CGACGACGAGCAGAAGCGCACGCTACTGTATTGCGTTGGCGCAGAGCGCAACGACGCGGCGCCCACGACGCGCGCACGCTGCGCGACAGTGGCGGCGGTG
GAGGTGGCGGAGGCACTTGGGCGGAGCGCCTTCTTGGCGACGACGCGCGCGGCAGAGCGGAGCGCGGACATGCTGCTGCTGGTCCTGCGGATGGTGGCAA
GCGCGTTTTTCCCCTGCGCAAGGCCACACGATACTGCTACAGGCGCCGATTTGAGTGGAAGCCCAATCGCCTCCCGATCTGCGCGACACCGGTTGTTTAC
CGGTTGTGTTTAGCACCGTTGTTTTAACCGGTCTAGTACCGGTTTGAGACCGACATTCAACTGATGTTAGAAAGTACTAGTATCGATACCGATTAGACAT
GAATGCCTACTAGTATGATACCGGTCAAACATTTACTGTACCGGTATATCACACTCGGTACCGGGTATCAGTAGAGAGATCAGGTATCAGCGTGCACTGT
AGGCTGCAGCTACAGTGTACCTACAACTGTACCCATCCATGCCCATGCGCAGGACGAGTATTGCAGCTTTGTGCCAGCGCATCTACACTTCGGCGCAGTG
CGTGGCTTCTTAGGCTGAGTACATGGAGTTTTGGTGCTACGTGCTTGCTGACTTTCTTGCAGAGATTCAAAGCGCACGACTAGAAAAGTGCATGTGGACA
CGAGATTCTGTGACACAAAATAACCAAAGCCCACGCTCTCCACTCAGGCGCTACTATCGAGGAAAACTGCATCGGTAAAGCCGACTCGTACATGCGCTTT
TCGCTTTACTAACGTATACTGACCTCATTGCGAGTCTGGCGTTCAAGCGAGCAAGTGCAGACGATCAGCTCGGGACTCGCACGCCAAGCCAAGCCTTCGT
ACTCGCTGGGAAGAAACAAACTGCAGAAGCGTGAAAGTATACCAGTCTCGGTCGGTATCCACGATGGTGCTTCCGGGTTTGAACAACGTGCTCTTACAGG
TCGTAGCGCTCAACGTTCTCATCGCTGTGGACCAAGTGCGTGCTCATGCGAGCGTCCAAGAAGGATCGATTCCAAACTGCGGCACCGCGACGTGGGGGCC
ATGGATTTGCGATGACGCGACTGGGATGGAGACGAGAACGCGGACGGGCCCAGCTCTTCCCAATCGCACATCCAACCAAACACAGGCGCGCCAGCCCGTG
CCGTGCACGACTGGAACCATCTCGCCGTGGTCTGCGTGCACAGCTCTCGGGGAGTCCAAGACCCGCACGGTACAGACCCTCACACCAGCAAAGT